ID: 1122810543

View in Genome Browser
Species Human (GRCh38)
Location 14:104285550-104285572
Sequence CTGTCATTGCAGATGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122810543_1122810549 5 Left 1122810543 14:104285550-104285572 CCAGGCTTCATCTGCAATGACAG No data
Right 1122810549 14:104285578-104285600 AGGCGGACAATGTGGGCACCCGG No data
1122810543_1122810550 12 Left 1122810543 14:104285550-104285572 CCAGGCTTCATCTGCAATGACAG No data
Right 1122810550 14:104285585-104285607 CAATGTGGGCACCCGGAGCGTGG No data
1122810543_1122810551 13 Left 1122810543 14:104285550-104285572 CCAGGCTTCATCTGCAATGACAG No data
Right 1122810551 14:104285586-104285608 AATGTGGGCACCCGGAGCGTGGG No data
1122810543_1122810548 -2 Left 1122810543 14:104285550-104285572 CCAGGCTTCATCTGCAATGACAG No data
Right 1122810548 14:104285571-104285593 AGGCAACAGGCGGACAATGTGGG No data
1122810543_1122810547 -3 Left 1122810543 14:104285550-104285572 CCAGGCTTCATCTGCAATGACAG No data
Right 1122810547 14:104285570-104285592 CAGGCAACAGGCGGACAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122810543 Original CRISPR CTGTCATTGCAGATGAAGCC TGG (reversed) Intergenic
No off target data available for this crispr