ID: 1122812429

View in Genome Browser
Species Human (GRCh38)
Location 14:104295693-104295715
Sequence TGGATCAATAGGCCACGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122812429_1122812435 -2 Left 1122812429 14:104295693-104295715 CCTGAACGTGGCCTATTGATCCA No data
Right 1122812435 14:104295714-104295736 CACGCCTGAGCCTGGCCGGGCGG No data
1122812429_1122812441 17 Left 1122812429 14:104295693-104295715 CCTGAACGTGGCCTATTGATCCA No data
Right 1122812441 14:104295733-104295755 GCGGCGCGTGCACTTGGCCAGGG No data
1122812429_1122812432 -6 Left 1122812429 14:104295693-104295715 CCTGAACGTGGCCTATTGATCCA No data
Right 1122812432 14:104295710-104295732 GATCCACGCCTGAGCCTGGCCGG No data
1122812429_1122812438 11 Left 1122812429 14:104295693-104295715 CCTGAACGTGGCCTATTGATCCA No data
Right 1122812438 14:104295727-104295749 GGCCGGGCGGCGCGTGCACTTGG No data
1122812429_1122812433 -5 Left 1122812429 14:104295693-104295715 CCTGAACGTGGCCTATTGATCCA No data
Right 1122812433 14:104295711-104295733 ATCCACGCCTGAGCCTGGCCGGG No data
1122812429_1122812440 16 Left 1122812429 14:104295693-104295715 CCTGAACGTGGCCTATTGATCCA No data
Right 1122812440 14:104295732-104295754 GGCGGCGCGTGCACTTGGCCAGG No data
1122812429_1122812431 -10 Left 1122812429 14:104295693-104295715 CCTGAACGTGGCCTATTGATCCA No data
Right 1122812431 14:104295706-104295728 TATTGATCCACGCCTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122812429 Original CRISPR TGGATCAATAGGCCACGTTC AGG (reversed) Intergenic
No off target data available for this crispr