ID: 1122812432

View in Genome Browser
Species Human (GRCh38)
Location 14:104295710-104295732
Sequence GATCCACGCCTGAGCCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122812429_1122812432 -6 Left 1122812429 14:104295693-104295715 CCTGAACGTGGCCTATTGATCCA No data
Right 1122812432 14:104295710-104295732 GATCCACGCCTGAGCCTGGCCGG No data
1122812426_1122812432 22 Left 1122812426 14:104295665-104295687 CCGCAAATGTATTTACAGCTATT No data
Right 1122812432 14:104295710-104295732 GATCCACGCCTGAGCCTGGCCGG No data
1122812425_1122812432 23 Left 1122812425 14:104295664-104295686 CCCGCAAATGTATTTACAGCTAT No data
Right 1122812432 14:104295710-104295732 GATCCACGCCTGAGCCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122812432 Original CRISPR GATCCACGCCTGAGCCTGGC CGG Intergenic
No off target data available for this crispr