ID: 1122812434

View in Genome Browser
Species Human (GRCh38)
Location 14:104295713-104295735
Sequence CGCCCGGCCAGGCTCAGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122812434_1122812441 -3 Left 1122812434 14:104295713-104295735 CCACGCCTGAGCCTGGCCGGGCG No data
Right 1122812441 14:104295733-104295755 GCGGCGCGTGCACTTGGCCAGGG No data
1122812434_1122812438 -9 Left 1122812434 14:104295713-104295735 CCACGCCTGAGCCTGGCCGGGCG No data
Right 1122812438 14:104295727-104295749 GGCCGGGCGGCGCGTGCACTTGG No data
1122812434_1122812444 18 Left 1122812434 14:104295713-104295735 CCACGCCTGAGCCTGGCCGGGCG No data
Right 1122812444 14:104295754-104295776 GGCAGCCCTGCGTGACGAATGGG No data
1122812434_1122812440 -4 Left 1122812434 14:104295713-104295735 CCACGCCTGAGCCTGGCCGGGCG No data
Right 1122812440 14:104295732-104295754 GGCGGCGCGTGCACTTGGCCAGG No data
1122812434_1122812443 17 Left 1122812434 14:104295713-104295735 CCACGCCTGAGCCTGGCCGGGCG No data
Right 1122812443 14:104295753-104295775 GGGCAGCCCTGCGTGACGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122812434 Original CRISPR CGCCCGGCCAGGCTCAGGCG TGG (reversed) Intergenic
No off target data available for this crispr