ID: 1122812436

View in Genome Browser
Species Human (GRCh38)
Location 14:104295718-104295740
Sequence CGCGCCGCCCGGCCAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122812436_1122812443 12 Left 1122812436 14:104295718-104295740 CCTGAGCCTGGCCGGGCGGCGCG No data
Right 1122812443 14:104295753-104295775 GGGCAGCCCTGCGTGACGAATGG No data
1122812436_1122812440 -9 Left 1122812436 14:104295718-104295740 CCTGAGCCTGGCCGGGCGGCGCG No data
Right 1122812440 14:104295732-104295754 GGCGGCGCGTGCACTTGGCCAGG No data
1122812436_1122812441 -8 Left 1122812436 14:104295718-104295740 CCTGAGCCTGGCCGGGCGGCGCG No data
Right 1122812441 14:104295733-104295755 GCGGCGCGTGCACTTGGCCAGGG No data
1122812436_1122812444 13 Left 1122812436 14:104295718-104295740 CCTGAGCCTGGCCGGGCGGCGCG No data
Right 1122812444 14:104295754-104295776 GGCAGCCCTGCGTGACGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122812436 Original CRISPR CGCGCCGCCCGGCCAGGCTC AGG (reversed) Intergenic
No off target data available for this crispr