ID: 1122812441

View in Genome Browser
Species Human (GRCh38)
Location 14:104295733-104295755
Sequence GCGGCGCGTGCACTTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122812430_1122812441 6 Left 1122812430 14:104295704-104295726 CCTATTGATCCACGCCTGAGCCT No data
Right 1122812441 14:104295733-104295755 GCGGCGCGTGCACTTGGCCAGGG No data
1122812436_1122812441 -8 Left 1122812436 14:104295718-104295740 CCTGAGCCTGGCCGGGCGGCGCG No data
Right 1122812441 14:104295733-104295755 GCGGCGCGTGCACTTGGCCAGGG No data
1122812429_1122812441 17 Left 1122812429 14:104295693-104295715 CCTGAACGTGGCCTATTGATCCA No data
Right 1122812441 14:104295733-104295755 GCGGCGCGTGCACTTGGCCAGGG No data
1122812434_1122812441 -3 Left 1122812434 14:104295713-104295735 CCACGCCTGAGCCTGGCCGGGCG No data
Right 1122812441 14:104295733-104295755 GCGGCGCGTGCACTTGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122812441 Original CRISPR GCGGCGCGTGCACTTGGCCA GGG Intergenic
No off target data available for this crispr