ID: 1122812443

View in Genome Browser
Species Human (GRCh38)
Location 14:104295753-104295775
Sequence GGGCAGCCCTGCGTGACGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122812436_1122812443 12 Left 1122812436 14:104295718-104295740 CCTGAGCCTGGCCGGGCGGCGCG No data
Right 1122812443 14:104295753-104295775 GGGCAGCCCTGCGTGACGAATGG No data
1122812434_1122812443 17 Left 1122812434 14:104295713-104295735 CCACGCCTGAGCCTGGCCGGGCG No data
Right 1122812443 14:104295753-104295775 GGGCAGCCCTGCGTGACGAATGG No data
1122812439_1122812443 1 Left 1122812439 14:104295729-104295751 CCGGGCGGCGCGTGCACTTGGCC No data
Right 1122812443 14:104295753-104295775 GGGCAGCCCTGCGTGACGAATGG No data
1122812430_1122812443 26 Left 1122812430 14:104295704-104295726 CCTATTGATCCACGCCTGAGCCT No data
Right 1122812443 14:104295753-104295775 GGGCAGCCCTGCGTGACGAATGG No data
1122812437_1122812443 6 Left 1122812437 14:104295724-104295746 CCTGGCCGGGCGGCGCGTGCACT No data
Right 1122812443 14:104295753-104295775 GGGCAGCCCTGCGTGACGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122812443 Original CRISPR GGGCAGCCCTGCGTGACGAA TGG Intergenic
No off target data available for this crispr