ID: 1122817507

View in Genome Browser
Species Human (GRCh38)
Location 14:104320880-104320902
Sequence GCTGGGTGTGGGCGGCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122817507_1122817517 4 Left 1122817507 14:104320880-104320902 CCGGGGAGCCGCCCACACCCAGC No data
Right 1122817517 14:104320907-104320929 GAGGAGGAGAGGAGTCCCAACGG No data
1122817507_1122817523 22 Left 1122817507 14:104320880-104320902 CCGGGGAGCCGCCCACACCCAGC No data
Right 1122817523 14:104320925-104320947 AACGGCGGGACTCTCGGCAGAGG No data
1122817507_1122817518 7 Left 1122817507 14:104320880-104320902 CCGGGGAGCCGCCCACACCCAGC No data
Right 1122817518 14:104320910-104320932 GAGGAGAGGAGTCCCAACGGCGG No data
1122817507_1122817514 -7 Left 1122817507 14:104320880-104320902 CCGGGGAGCCGCCCACACCCAGC No data
Right 1122817514 14:104320896-104320918 ACCCAGCTGGAGAGGAGGAGAGG No data
1122817507_1122817525 27 Left 1122817507 14:104320880-104320902 CCGGGGAGCCGCCCACACCCAGC No data
Right 1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG No data
1122817507_1122817520 16 Left 1122817507 14:104320880-104320902 CCGGGGAGCCGCCCACACCCAGC No data
Right 1122817520 14:104320919-104320941 AGTCCCAACGGCGGGACTCTCGG No data
1122817507_1122817526 28 Left 1122817507 14:104320880-104320902 CCGGGGAGCCGCCCACACCCAGC No data
Right 1122817526 14:104320931-104320953 GGGACTCTCGGCAGAGGCTGGGG No data
1122817507_1122817524 26 Left 1122817507 14:104320880-104320902 CCGGGGAGCCGCCCACACCCAGC No data
Right 1122817524 14:104320929-104320951 GCGGGACTCTCGGCAGAGGCTGG No data
1122817507_1122817519 8 Left 1122817507 14:104320880-104320902 CCGGGGAGCCGCCCACACCCAGC No data
Right 1122817519 14:104320911-104320933 AGGAGAGGAGTCCCAACGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122817507 Original CRISPR GCTGGGTGTGGGCGGCTCCC CGG (reversed) Intergenic