ID: 1122817511

View in Genome Browser
Species Human (GRCh38)
Location 14:104320891-104320913
Sequence CCTCCTCTCCAGCTGGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122817511_1122817528 22 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817528 14:104320936-104320958 TCTCGGCAGAGGCTGGGGAAGGG No data
1122817511_1122817525 16 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG No data
1122817511_1122817526 17 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817526 14:104320931-104320953 GGGACTCTCGGCAGAGGCTGGGG No data
1122817511_1122817518 -4 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817518 14:104320910-104320932 GAGGAGAGGAGTCCCAACGGCGG No data
1122817511_1122817517 -7 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817517 14:104320907-104320929 GAGGAGGAGAGGAGTCCCAACGG No data
1122817511_1122817529 23 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817529 14:104320937-104320959 CTCGGCAGAGGCTGGGGAAGGGG No data
1122817511_1122817530 24 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817530 14:104320938-104320960 TCGGCAGAGGCTGGGGAAGGGGG No data
1122817511_1122817527 21 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817527 14:104320935-104320957 CTCTCGGCAGAGGCTGGGGAAGG No data
1122817511_1122817523 11 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817523 14:104320925-104320947 AACGGCGGGACTCTCGGCAGAGG No data
1122817511_1122817524 15 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817524 14:104320929-104320951 GCGGGACTCTCGGCAGAGGCTGG No data
1122817511_1122817519 -3 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817519 14:104320911-104320933 AGGAGAGGAGTCCCAACGGCGGG No data
1122817511_1122817520 5 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817520 14:104320919-104320941 AGTCCCAACGGCGGGACTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122817511 Original CRISPR CCTCCTCTCCAGCTGGGTGT GGG (reversed) Intergenic