ID: 1122817516

View in Genome Browser
Species Human (GRCh38)
Location 14:104320898-104320920
Sequence CTCCTCTCCTCCTCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122817516_1122817525 9 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG No data
1122817516_1122817523 4 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817523 14:104320925-104320947 AACGGCGGGACTCTCGGCAGAGG No data
1122817516_1122817519 -10 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817519 14:104320911-104320933 AGGAGAGGAGTCCCAACGGCGGG No data
1122817516_1122817527 14 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817527 14:104320935-104320957 CTCTCGGCAGAGGCTGGGGAAGG No data
1122817516_1122817528 15 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817528 14:104320936-104320958 TCTCGGCAGAGGCTGGGGAAGGG No data
1122817516_1122817530 17 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817530 14:104320938-104320960 TCGGCAGAGGCTGGGGAAGGGGG No data
1122817516_1122817524 8 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817524 14:104320929-104320951 GCGGGACTCTCGGCAGAGGCTGG No data
1122817516_1122817520 -2 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817520 14:104320919-104320941 AGTCCCAACGGCGGGACTCTCGG No data
1122817516_1122817526 10 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817526 14:104320931-104320953 GGGACTCTCGGCAGAGGCTGGGG No data
1122817516_1122817529 16 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817529 14:104320937-104320959 CTCGGCAGAGGCTGGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122817516 Original CRISPR CTCCTCTCCTCCTCTCCAGC TGG (reversed) Intergenic