ID: 1122817525

View in Genome Browser
Species Human (GRCh38)
Location 14:104320930-104320952
Sequence CGGGACTCTCGGCAGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122817513_1122817525 15 Left 1122817513 14:104320892-104320914 CCACACCCAGCTGGAGAGGAGGA No data
Right 1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG No data
1122817509_1122817525 19 Left 1122817509 14:104320888-104320910 CCGCCCACACCCAGCTGGAGAGG No data
Right 1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG No data
1122817516_1122817525 9 Left 1122817516 14:104320898-104320920 CCAGCTGGAGAGGAGGAGAGGAG No data
Right 1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG No data
1122817515_1122817525 10 Left 1122817515 14:104320897-104320919 CCCAGCTGGAGAGGAGGAGAGGA No data
Right 1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG No data
1122817507_1122817525 27 Left 1122817507 14:104320880-104320902 CCGGGGAGCCGCCCACACCCAGC No data
Right 1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG No data
1122817511_1122817525 16 Left 1122817511 14:104320891-104320913 CCCACACCCAGCTGGAGAGGAGG No data
Right 1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122817525 Original CRISPR CGGGACTCTCGGCAGAGGCT GGG Intergenic
No off target data available for this crispr