ID: 1122822010

View in Genome Browser
Species Human (GRCh38)
Location 14:104352310-104352332
Sequence GCGCCTTCTCCTGGTGCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122822005_1122822010 -8 Left 1122822005 14:104352295-104352317 CCTCCCGTTCCTCAGGCGCCTTC No data
Right 1122822010 14:104352310-104352332 GCGCCTTCTCCTGGTGCTCACGG No data
1122822003_1122822010 22 Left 1122822003 14:104352265-104352287 CCTTAGTGGGTGAATGGTGTGTG No data
Right 1122822010 14:104352310-104352332 GCGCCTTCTCCTGGTGCTCACGG No data
1122822002_1122822010 23 Left 1122822002 14:104352264-104352286 CCCTTAGTGGGTGAATGGTGTGT No data
Right 1122822010 14:104352310-104352332 GCGCCTTCTCCTGGTGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122822010 Original CRISPR GCGCCTTCTCCTGGTGCTCA CGG Intergenic
No off target data available for this crispr