ID: 1122822425

View in Genome Browser
Species Human (GRCh38)
Location 14:104354289-104354311
Sequence CCCAGGGCCCCTCTATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122822425_1122822440 21 Left 1122822425 14:104354289-104354311 CCTGGAGATAGAGGGGCCCTGGG No data
Right 1122822440 14:104354333-104354355 GTGCTAGAGAACTTGGCATCTGG No data
1122822425_1122822432 -1 Left 1122822425 14:104354289-104354311 CCTGGAGATAGAGGGGCCCTGGG No data
Right 1122822432 14:104354311-104354333 GTTGGCCCTGGAGCCCCCGGTGG No data
1122822425_1122822431 -4 Left 1122822425 14:104354289-104354311 CCTGGAGATAGAGGGGCCCTGGG No data
Right 1122822431 14:104354308-104354330 TGGGTTGGCCCTGGAGCCCCCGG No data
1122822425_1122822441 22 Left 1122822425 14:104354289-104354311 CCTGGAGATAGAGGGGCCCTGGG No data
Right 1122822441 14:104354334-104354356 TGCTAGAGAACTTGGCATCTGGG No data
1122822425_1122822438 14 Left 1122822425 14:104354289-104354311 CCTGGAGATAGAGGGGCCCTGGG No data
Right 1122822438 14:104354326-104354348 CCCGGTGGTGCTAGAGAACTTGG No data
1122822425_1122822442 28 Left 1122822425 14:104354289-104354311 CCTGGAGATAGAGGGGCCCTGGG No data
Right 1122822442 14:104354340-104354362 AGAACTTGGCATCTGGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122822425 Original CRISPR CCCAGGGCCCCTCTATCTCC AGG (reversed) Intergenic
No off target data available for this crispr