ID: 1122822728

View in Genome Browser
Species Human (GRCh38)
Location 14:104355289-104355311
Sequence CTGTGCAAGGTGACAGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122822728_1122822734 7 Left 1122822728 14:104355289-104355311 CCGTCCACTGTCACCTTGCACAG No data
Right 1122822734 14:104355319-104355341 CTCGCTCTCCTGACTGGGACCGG No data
1122822728_1122822738 27 Left 1122822728 14:104355289-104355311 CCGTCCACTGTCACCTTGCACAG No data
Right 1122822738 14:104355339-104355361 CGGCCTCTCCCAGCCAAGCTGGG No data
1122822728_1122822733 2 Left 1122822728 14:104355289-104355311 CCGTCCACTGTCACCTTGCACAG No data
Right 1122822733 14:104355314-104355336 TTCGACTCGCTCTCCTGACTGGG No data
1122822728_1122822737 26 Left 1122822728 14:104355289-104355311 CCGTCCACTGTCACCTTGCACAG No data
Right 1122822737 14:104355338-104355360 CCGGCCTCTCCCAGCCAAGCTGG No data
1122822728_1122822732 1 Left 1122822728 14:104355289-104355311 CCGTCCACTGTCACCTTGCACAG No data
Right 1122822732 14:104355313-104355335 CTTCGACTCGCTCTCCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122822728 Original CRISPR CTGTGCAAGGTGACAGTGGA CGG (reversed) Intergenic
No off target data available for this crispr