ID: 1122827604

View in Genome Browser
Species Human (GRCh38)
Location 14:104377916-104377938
Sequence CAGGGCAATCGTACATATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122827598_1122827604 7 Left 1122827598 14:104377886-104377908 CCATTGGGTCTCTATCTAAGGGG No data
Right 1122827604 14:104377916-104377938 CAGGGCAATCGTACATATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122827604 Original CRISPR CAGGGCAATCGTACATATGC AGG Intergenic
No off target data available for this crispr