ID: 1122829394

View in Genome Browser
Species Human (GRCh38)
Location 14:104388374-104388396
Sequence CGCCCCGTCGGCGACTCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122829390_1122829394 2 Left 1122829390 14:104388349-104388371 CCGGTTGATTGCTCGGGGCGGCC No data
Right 1122829394 14:104388374-104388396 CGCCCCGTCGGCGACTCCATCGG No data
1122829385_1122829394 9 Left 1122829385 14:104388342-104388364 CCGCGGACCGGTTGATTGCTCGG No data
Right 1122829394 14:104388374-104388396 CGCCCCGTCGGCGACTCCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122829394 Original CRISPR CGCCCCGTCGGCGACTCCAT CGG Intergenic
No off target data available for this crispr