ID: 1122835579

View in Genome Browser
Species Human (GRCh38)
Location 14:104429282-104429304
Sequence GGGAAACTGTCCCAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122835579_1122835585 13 Left 1122835579 14:104429282-104429304 CCTCCTGGCTGGGACAGTTTCCC No data
Right 1122835585 14:104429318-104429340 TGATGACCTTGACAGTGGTGAGG No data
1122835579_1122835584 8 Left 1122835579 14:104429282-104429304 CCTCCTGGCTGGGACAGTTTCCC No data
Right 1122835584 14:104429313-104429335 TGTTTTGATGACCTTGACAGTGG No data
1122835579_1122835587 21 Left 1122835579 14:104429282-104429304 CCTCCTGGCTGGGACAGTTTCCC No data
Right 1122835587 14:104429326-104429348 TTGACAGTGGTGAGGTGCCCTGG No data
1122835579_1122835588 22 Left 1122835579 14:104429282-104429304 CCTCCTGGCTGGGACAGTTTCCC No data
Right 1122835588 14:104429327-104429349 TGACAGTGGTGAGGTGCCCTGGG No data
1122835579_1122835590 26 Left 1122835579 14:104429282-104429304 CCTCCTGGCTGGGACAGTTTCCC No data
Right 1122835590 14:104429331-104429353 AGTGGTGAGGTGCCCTGGGCGGG No data
1122835579_1122835589 25 Left 1122835579 14:104429282-104429304 CCTCCTGGCTGGGACAGTTTCCC No data
Right 1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122835579 Original CRISPR GGGAAACTGTCCCAGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr