ID: 1122835581

View in Genome Browser
Species Human (GRCh38)
Location 14:104429302-104429324
Sequence GTCATCAAAACAAGGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122835581_1122835589 5 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG No data
1122835581_1122835588 2 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835588 14:104429327-104429349 TGACAGTGGTGAGGTGCCCTGGG No data
1122835581_1122835595 30 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835595 14:104429355-104429377 ACTTTGAAGGATGCCCCCGCGGG No data
1122835581_1122835590 6 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835590 14:104429331-104429353 AGTGGTGAGGTGCCCTGGGCGGG No data
1122835581_1122835587 1 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835587 14:104429326-104429348 TTGACAGTGGTGAGGTGCCCTGG No data
1122835581_1122835594 29 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835594 14:104429354-104429376 CACTTTGAAGGATGCCCCCGCGG No data
1122835581_1122835591 17 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835591 14:104429342-104429364 GCCCTGGGCGGGCACTTTGAAGG No data
1122835581_1122835585 -7 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835585 14:104429318-104429340 TGATGACCTTGACAGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122835581 Original CRISPR GTCATCAAAACAAGGAAAGT GGG (reversed) Intergenic
No off target data available for this crispr