ID: 1122835585

View in Genome Browser
Species Human (GRCh38)
Location 14:104429318-104429340
Sequence TGATGACCTTGACAGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122835575_1122835585 25 Left 1122835575 14:104429270-104429292 CCTCCTTGGACACCTCCTGGCTG No data
Right 1122835585 14:104429318-104429340 TGATGACCTTGACAGTGGTGAGG No data
1122835579_1122835585 13 Left 1122835579 14:104429282-104429304 CCTCCTGGCTGGGACAGTTTCCC No data
Right 1122835585 14:104429318-104429340 TGATGACCTTGACAGTGGTGAGG No data
1122835580_1122835585 10 Left 1122835580 14:104429285-104429307 CCTGGCTGGGACAGTTTCCCACT No data
Right 1122835585 14:104429318-104429340 TGATGACCTTGACAGTGGTGAGG No data
1122835578_1122835585 22 Left 1122835578 14:104429273-104429295 CCTTGGACACCTCCTGGCTGGGA No data
Right 1122835585 14:104429318-104429340 TGATGACCTTGACAGTGGTGAGG No data
1122835582_1122835585 -8 Left 1122835582 14:104429303-104429325 CCACTTTCCTTGTTTTGATGACC No data
Right 1122835585 14:104429318-104429340 TGATGACCTTGACAGTGGTGAGG No data
1122835581_1122835585 -7 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835585 14:104429318-104429340 TGATGACCTTGACAGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122835585 Original CRISPR TGATGACCTTGACAGTGGTG AGG Intergenic
No off target data available for this crispr