ID: 1122835587

View in Genome Browser
Species Human (GRCh38)
Location 14:104429326-104429348
Sequence TTGACAGTGGTGAGGTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122835582_1122835587 0 Left 1122835582 14:104429303-104429325 CCACTTTCCTTGTTTTGATGACC No data
Right 1122835587 14:104429326-104429348 TTGACAGTGGTGAGGTGCCCTGG No data
1122835578_1122835587 30 Left 1122835578 14:104429273-104429295 CCTTGGACACCTCCTGGCTGGGA No data
Right 1122835587 14:104429326-104429348 TTGACAGTGGTGAGGTGCCCTGG No data
1122835583_1122835587 -7 Left 1122835583 14:104429310-104429332 CCTTGTTTTGATGACCTTGACAG No data
Right 1122835587 14:104429326-104429348 TTGACAGTGGTGAGGTGCCCTGG No data
1122835581_1122835587 1 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835587 14:104429326-104429348 TTGACAGTGGTGAGGTGCCCTGG No data
1122835579_1122835587 21 Left 1122835579 14:104429282-104429304 CCTCCTGGCTGGGACAGTTTCCC No data
Right 1122835587 14:104429326-104429348 TTGACAGTGGTGAGGTGCCCTGG No data
1122835580_1122835587 18 Left 1122835580 14:104429285-104429307 CCTGGCTGGGACAGTTTCCCACT No data
Right 1122835587 14:104429326-104429348 TTGACAGTGGTGAGGTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122835587 Original CRISPR TTGACAGTGGTGAGGTGCCC TGG Intergenic
No off target data available for this crispr