ID: 1122835590

View in Genome Browser
Species Human (GRCh38)
Location 14:104429331-104429353
Sequence AGTGGTGAGGTGCCCTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122835582_1122835590 5 Left 1122835582 14:104429303-104429325 CCACTTTCCTTGTTTTGATGACC No data
Right 1122835590 14:104429331-104429353 AGTGGTGAGGTGCCCTGGGCGGG No data
1122835583_1122835590 -2 Left 1122835583 14:104429310-104429332 CCTTGTTTTGATGACCTTGACAG No data
Right 1122835590 14:104429331-104429353 AGTGGTGAGGTGCCCTGGGCGGG No data
1122835581_1122835590 6 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835590 14:104429331-104429353 AGTGGTGAGGTGCCCTGGGCGGG No data
1122835580_1122835590 23 Left 1122835580 14:104429285-104429307 CCTGGCTGGGACAGTTTCCCACT No data
Right 1122835590 14:104429331-104429353 AGTGGTGAGGTGCCCTGGGCGGG No data
1122835579_1122835590 26 Left 1122835579 14:104429282-104429304 CCTCCTGGCTGGGACAGTTTCCC No data
Right 1122835590 14:104429331-104429353 AGTGGTGAGGTGCCCTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122835590 Original CRISPR AGTGGTGAGGTGCCCTGGGC GGG Intergenic
No off target data available for this crispr