ID: 1122835591

View in Genome Browser
Species Human (GRCh38)
Location 14:104429342-104429364
Sequence GCCCTGGGCGGGCACTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122835582_1122835591 16 Left 1122835582 14:104429303-104429325 CCACTTTCCTTGTTTTGATGACC No data
Right 1122835591 14:104429342-104429364 GCCCTGGGCGGGCACTTTGAAGG No data
1122835583_1122835591 9 Left 1122835583 14:104429310-104429332 CCTTGTTTTGATGACCTTGACAG No data
Right 1122835591 14:104429342-104429364 GCCCTGGGCGGGCACTTTGAAGG No data
1122835586_1122835591 -5 Left 1122835586 14:104429324-104429346 CCTTGACAGTGGTGAGGTGCCCT No data
Right 1122835591 14:104429342-104429364 GCCCTGGGCGGGCACTTTGAAGG No data
1122835581_1122835591 17 Left 1122835581 14:104429302-104429324 CCCACTTTCCTTGTTTTGATGAC No data
Right 1122835591 14:104429342-104429364 GCCCTGGGCGGGCACTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122835591 Original CRISPR GCCCTGGGCGGGCACTTTGA AGG Intergenic
No off target data available for this crispr