ID: 1122842600

View in Genome Browser
Species Human (GRCh38)
Location 14:104473674-104473696
Sequence CTTGAAGCCCAGCCTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122842596_1122842600 3 Left 1122842596 14:104473648-104473670 CCTCTGGTGCCAGCTCTGAGGCC No data
Right 1122842600 14:104473674-104473696 CTTGAAGCCCAGCCTGAAGGTGG No data
1122842597_1122842600 -6 Left 1122842597 14:104473657-104473679 CCAGCTCTGAGGCCTCTCTTGAA No data
Right 1122842600 14:104473674-104473696 CTTGAAGCCCAGCCTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122842600 Original CRISPR CTTGAAGCCCAGCCTGAAGG TGG Intergenic
No off target data available for this crispr