ID: 1122844408

View in Genome Browser
Species Human (GRCh38)
Location 14:104483775-104483797
Sequence GAGGGACTTTGCCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122844397_1122844408 29 Left 1122844397 14:104483723-104483745 CCTGGGGAACCTTTCTTGTGCAA 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1122844408 14:104483775-104483797 GAGGGACTTTGCCAGGTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 263
1122844398_1122844408 20 Left 1122844398 14:104483732-104483754 CCTTTCTTGTGCAAACATGCAAC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1122844408 14:104483775-104483797 GAGGGACTTTGCCAGGTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 263
1122844403_1122844408 -8 Left 1122844403 14:104483760-104483782 CCCTAGTCTAGGAGAGAGGGACT 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1122844408 14:104483775-104483797 GAGGGACTTTGCCAGGTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 263
1122844404_1122844408 -9 Left 1122844404 14:104483761-104483783 CCTAGTCTAGGAGAGAGGGACTT 0: 1
1: 0
2: 1
3: 5
4: 138
Right 1122844408 14:104483775-104483797 GAGGGACTTTGCCAGGTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122844408 Original CRISPR GAGGGACTTTGCCAGGTGGA GGG Intronic
900562539 1:3314478-3314500 GGGGGACTTTGTAAGGTGGGAGG - Intronic
901330923 1:8407878-8407900 TAGGGTTTCTGCCAGGTGGAGGG - Intronic
901527824 1:9835344-9835366 GAAGGATTTGGCCAGGTAGAGGG - Intergenic
901901040 1:12362829-12362851 GAGGGAATTTGCCAGGGGACAGG + Exonic
902741428 1:18441213-18441235 GAGGGGCTGTGCTAGGTAGAAGG - Intergenic
905323683 1:37135012-37135034 GTGGGAGTTTGCTGGGTGGAGGG + Intergenic
909735827 1:78960708-78960730 TAGGAACTTTTCCAGGTGAATGG + Intronic
912302407 1:108531760-108531782 GAGGCCCTAGGCCAGGTGGATGG + Intergenic
912736604 1:112154515-112154537 GAGGGAGTTGGCCATGTGAAGGG + Intergenic
912941107 1:114045622-114045644 GCTGGACTTGGACAGGTGGAGGG + Intergenic
913223406 1:116677654-116677676 GTGGGAGTTTGCCAAGTTGACGG - Intergenic
916840872 1:168599299-168599321 AAGGGACCCTGCCATGTGGAAGG - Intergenic
916943722 1:169702797-169702819 CAGGCACTGTGTCAGGTGGAGGG + Intronic
917157886 1:172024735-172024757 GAGGGACTGTGCCTAGAGGAAGG + Intronic
917669093 1:177255916-177255938 CAGGGAGTTTGCCCGTTGGAAGG + Exonic
918247358 1:182671682-182671704 GAGGGTCTTTGCCAACTGGATGG + Exonic
919455554 1:197816112-197816134 GAGGGACATGGCCAGCTCGAGGG + Intergenic
921602454 1:217121047-217121069 GATGGACTTTGCCTGGGGGAAGG + Intronic
922464132 1:225835073-225835095 GTGGGACTTTGCCAGGTGTGTGG + Intronic
1063385411 10:5613506-5613528 GAAGAACTTTTCCCGGTGGAGGG - Intergenic
1063423770 10:5935458-5935480 GAGGGACCTCGCCAGGTTCATGG + Intronic
1063856534 10:10260563-10260585 GAAAGTCTTGGCCAGGTGGATGG - Intergenic
1067364999 10:45618219-45618241 GAGGGGCTTTCACAGGTGGGAGG + Exonic
1069574508 10:69517113-69517135 GAGTGGCTGTGCCAGGTGTACGG + Intergenic
1070894516 10:79971978-79972000 AAGGGAGTTTGGGAGGTGGAGGG - Intronic
1072425425 10:95326016-95326038 TTGGGCCTTTGCCAGGTGGCTGG + Intronic
1076109626 10:127850940-127850962 GTGGGACTTGGCTAGGAGGAGGG + Intergenic
1077888688 11:6403815-6403837 GAAGGAATCTGCCAGGTGGGAGG + Exonic
1078463894 11:11535951-11535973 GAGGGCCTTTCCCATGTAGAGGG + Intronic
1078567873 11:12432544-12432566 GAGGTAACTTGCAAGGTGGATGG + Intronic
1078747788 11:14131921-14131943 AAGGCACTTGGCCAGGGGGAAGG - Intronic
1079006082 11:16791956-16791978 GAGGGAATTTAGGAGGTGGAAGG - Intronic
1080556361 11:33421064-33421086 GAGAGACTTTTCCAGGTGGGAGG - Intergenic
1080587854 11:33697583-33697605 TAGGGAATGTGCCAGGTAGAAGG - Intergenic
1081701744 11:45156836-45156858 GCGGGGGTTTGCCAGGCGGAGGG + Intronic
1081862861 11:46343884-46343906 GAGTGACTTAGGCAGGGGGAGGG - Intronic
1083172525 11:60931419-60931441 GAGCCACCTTGCCAGGTGGGAGG + Intronic
1084150125 11:67284194-67284216 CAGTAACTTTACCAGGTGGATGG - Exonic
1085050490 11:73377608-73377630 GCAGAACTTTGCCAGGTGTAGGG - Intronic
1085254944 11:75167095-75167117 GAAGGACCTTGGCAGCTGGAGGG + Intronic
1085424686 11:76393579-76393601 AGGGGAGTTTCCCAGGTGGATGG - Intronic
1085642300 11:78200224-78200246 AGGGGACCTTACCAGGTGGAAGG - Exonic
1085758873 11:79224661-79224683 GGGAAACTTGGCCAGGTGGATGG + Intronic
1085955185 11:81384182-81384204 GAGGAATTTTGATAGGTGGAGGG + Intergenic
1086281490 11:85194709-85194731 TAGGGGCTTAGCCAGGAGGATGG - Intronic
1086848631 11:91782848-91782870 CTGTGACTTTTCCAGGTGGATGG + Intergenic
1088303692 11:108385956-108385978 TAGGTACATTGCCAGCTGGAAGG - Exonic
1088946605 11:114519621-114519643 TTGGGAGTTTGACAGGTGGAAGG + Intergenic
1089350229 11:117817826-117817848 AAGGGCCTTTGCCGGGAGGAGGG - Intronic
1089451590 11:118601780-118601802 GAGGGACTGTGCCATTTGAAAGG - Exonic
1089708978 11:120301610-120301632 GAGGGACTCTGCCTGGTTGGTGG - Intronic
1089807508 11:121104718-121104740 CAGGGACTTTCCCAAGTAGAAGG + Intronic
1091034869 11:132224049-132224071 GAGCAACATTGCCAGGTGGCAGG + Intronic
1091331901 11:134737037-134737059 GGGTGTCTGTGCCAGGTGGAGGG - Intergenic
1095123397 12:38445028-38445050 GGGGGGCTTTGCCAGCTGTAGGG - Intergenic
1095373634 12:41500249-41500271 CAGGGACTTTGCCAGGCAGCTGG - Intronic
1095646941 12:44558608-44558630 GAGGGACTGTGCCATGAGGAAGG + Intronic
1095942371 12:47735520-47735542 GAGAGACCTTGCCAGGAGAATGG - Intronic
1096070298 12:48771690-48771712 GAGGTACTTTTCCAGTTGGCTGG - Exonic
1097526245 12:60739903-60739925 GAGTGACTTTTCCAGGAGCATGG + Intergenic
1098198528 12:68028705-68028727 GCTGGACTTTCCCGGGTGGAAGG - Intergenic
1098270195 12:68762469-68762491 GAGGGACTGAGTGAGGTGGAGGG + Intronic
1101631617 12:106500557-106500579 GAGTGACGATGCCAGGTGGGAGG + Intronic
1102024832 12:109708473-109708495 GAGGGGGTCTCCCAGGTGGAAGG + Intergenic
1102198521 12:111041696-111041718 GAGGGACATTTCCAGGCAGAGGG + Intronic
1102476608 12:113192702-113192724 CTAGGACTTTGCCAAGTGGAGGG + Intergenic
1104071753 12:125351959-125351981 GAGGGAGACTGGCAGGTGGAAGG - Intronic
1104537204 12:129629155-129629177 GAGGGAATATCCCAGATGGAGGG - Intronic
1104726343 12:131077844-131077866 GAGGCACTTTGAGAGGCGGAAGG - Intronic
1106160353 13:27195758-27195780 GAGGGGCATTCACAGGTGGAGGG + Intergenic
1106796996 13:33216972-33216994 AATGGAGGTTGCCAGGTGGAGGG + Intronic
1106856782 13:33862139-33862161 GAGCGACTTAGCTAAGTGGAAGG - Intronic
1107423070 13:40267846-40267868 GATGGAATTTTCCAGGTTGAGGG + Intergenic
1111550425 13:89803345-89803367 GAGGGACTTTGCTAGCAAGAAGG + Intergenic
1111686814 13:91512533-91512555 CAGGGCCTTTGCCAAGTGCAGGG - Intronic
1112508955 13:99991629-99991651 GGGGGGCTTTGCCTGGTGGTAGG - Intergenic
1113364435 13:109662928-109662950 GAGGAACTTTTCCAGGTGAATGG + Intergenic
1115471224 14:33770536-33770558 GAGGGACCTTGCTAGGTGCCAGG - Intronic
1115507317 14:34104795-34104817 GAGGGGCTTTTCCAGGTCTAAGG + Intronic
1115721151 14:36162435-36162457 GAGGGACTGTGCCATGAGGAAGG - Intergenic
1117211928 14:53509584-53509606 GAGGGTCCTCGCCAGGAGGAGGG - Intergenic
1117725965 14:58674096-58674118 GAGGAACTGTCCCAGGTGCAAGG - Intergenic
1118170477 14:63384111-63384133 AAAGGAATTTGGCAGGTGGATGG - Intronic
1118702414 14:68446725-68446747 GAGAGAATGTTCCAGGTGGAAGG + Intronic
1119099813 14:71869405-71869427 GGGGACCTTTCCCAGGTGGAGGG + Intergenic
1120091939 14:80342208-80342230 GAGAGAGTATTCCAGGTGGAAGG + Intronic
1121120760 14:91374547-91374569 GAGGGTGTGAGCCAGGTGGACGG + Intronic
1122687743 14:103518094-103518116 GAGGGACTGAGCCAGCAGGAGGG + Intergenic
1122844408 14:104483775-104483797 GAGGGACTTTGCCAGGTGGAGGG + Intronic
1122857861 14:104568506-104568528 GATGGAGTTTGCCAGGGGCAGGG + Intronic
1124625387 15:31304643-31304665 GAATGACTTTGCAAGCTGGAAGG + Intergenic
1124911404 15:33924559-33924581 GAGAGGCTGTGGCAGGTGGATGG - Intronic
1127366284 15:58293719-58293741 AATGGGCTTTGCAAGGTGGAGGG + Intronic
1132194051 15:99896991-99897013 CTGTGACTTTTCCAGGTGGATGG + Intergenic
1135041752 16:19122782-19122804 GTGGGAATTAGCCAGGTGAAGGG + Intronic
1135956787 16:26962630-26962652 AATGGAAGTTGCCAGGTGGAGGG + Intergenic
1136364986 16:29805874-29805896 GAGGGACTCTGGCGGGAGGAGGG - Intergenic
1137694673 16:50453669-50453691 CAAGGACTCTGCCAGGAGGAGGG - Intergenic
1138502491 16:57456330-57456352 AAGGGGCTTTGCAGGGTGGAGGG + Intronic
1138585193 16:57964697-57964719 AAGGGAGTATCCCAGGTGGAAGG - Intronic
1138985033 16:62318137-62318159 GAGGAACTATTCCAGATGGAAGG + Intergenic
1139740596 16:69032021-69032043 GAGGGAGCATTCCAGGTGGAGGG + Intronic
1144782523 17:17815183-17815205 GAGGGGCCTTGCCTGGAGGAGGG + Intronic
1147840991 17:43371291-43371313 GTGGGCCTTTGCCAGGAGCACGG + Intergenic
1148506028 17:48127810-48127832 GTGGCGCTTTGCCAGTTGGAGGG + Intergenic
1150064674 17:62099079-62099101 GAGGGAGTTTGCAAGGTGTCTGG + Intergenic
1150302800 17:64060206-64060228 GTAGGATTTGGCCAGGTGGAGGG - Intronic
1150526296 17:65926371-65926393 TATAGCCTTTGCCAGGTGGAGGG - Intronic
1152022311 17:77786607-77786629 CAGGGACTGAGCCAGGTGGCCGG + Intergenic
1152071660 17:78137205-78137227 CAGGGACCTTGTCAGGTGGAGGG - Intronic
1152161118 17:78669356-78669378 GAGGGACTCTGGCTGCTGGAGGG - Intergenic
1152538197 17:80962393-80962415 GAGGGGCCTGGCCAGGGGGACGG - Intronic
1153192169 18:2553256-2553278 GAGGAACTTTTCCAGGTTGGAGG - Intronic
1153945562 18:10014240-10014262 GAGAGACTTTTCCAGGAGGTGGG - Intergenic
1157071684 18:44416153-44416175 GAGGGACTGTGCTAGGAGGAAGG + Intergenic
1157298071 18:46460035-46460057 GGGGGTCCTGGCCAGGTGGAGGG - Exonic
1157482059 18:48061351-48061373 GTGGGACTATACCAGGTGGGTGG - Intronic
1158572071 18:58604823-58604845 GAGGGAACTTGCCCTGTGGAAGG - Intronic
1160620063 18:80164315-80164337 TTGGGACTTGGCCAGGAGGAGGG - Intronic
1161124132 19:2546442-2546464 GAGGGCCTCTGCCACATGGAAGG + Intronic
1162911241 19:13848933-13848955 CAGGAACTTTTCCAAGTGGAAGG - Intergenic
1163343749 19:16726982-16727004 GAAGGACTTTGCCTCGTGGGAGG + Intronic
1163828122 19:19535161-19535183 CAGGGACTTTGGGAGGTCGAAGG - Intronic
1164922017 19:32095362-32095384 GAGGGAATCTGGCTGGTGGAGGG - Intergenic
1165146782 19:33735954-33735976 TAAGGACATTGCCAGGTGGCGGG - Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1165454319 19:35901911-35901933 GAGGAACTTTGCCAGGGAAATGG - Intronic
1167165115 19:47793902-47793924 GAGAGGCTTTGGCAGGAGGATGG - Intergenic
1167728499 19:51235501-51235523 GAGGGACTTTGGCAGGTAAAGGG - Intronic
1168003486 19:53467632-53467654 GAGAGACTTTGCCCTTTGGAAGG - Intergenic
1168103650 19:54153936-54153958 GAGGGACTGCGCCAGCTGAAAGG - Intronic
1168411249 19:56141538-56141560 GAGGGACTTGGAGAGGGGGAGGG + Intronic
925810475 2:7695234-7695256 GAGGGACATTGGAAGGTGGGAGG - Intergenic
927962585 2:27250219-27250241 GAGGGTCTCTGCCTGGCGGAGGG + Intergenic
928174827 2:29026510-29026532 GTAGGACTTTTCTAGGTGGAGGG + Intronic
928336292 2:30401258-30401280 GAGGGTGTCTGCCAGCTGGAAGG - Intergenic
928748601 2:34444949-34444971 GAGGGACTATTGCAGGTGGAAGG + Intergenic
930470556 2:51806629-51806651 CAAGGACTTGGCCAGGAGGAAGG - Intergenic
931441268 2:62292520-62292542 CAGGGACTCTGGCAGGTGGCAGG - Intergenic
931855962 2:66302017-66302039 CAAGGACATTGCGAGGTGGAGGG - Intergenic
932448253 2:71793837-71793859 GAGGGCTTGTGTCAGGTGGAGGG - Intergenic
932746918 2:74341524-74341546 GAGGCACTTTGCCAGGCTGTGGG - Intronic
934896663 2:98125599-98125621 GAGGCATTTTGCCAGTTTGATGG + Intronic
936350511 2:111708860-111708882 AAGGGTTATTGCCAGGTGGAGGG - Intergenic
938583919 2:132670689-132670711 GTGGAACTTTGCCAGGCGCACGG - Intronic
940030617 2:149257853-149257875 GAGGGACTCTGCCATAGGGATGG - Intergenic
943081549 2:183263762-183263784 GAGAGACTGGGCCAGGTGAAAGG + Intergenic
944635345 2:201670992-201671014 GAGGGACTTTGCAGTGAGGAAGG + Intronic
944847580 2:203684137-203684159 AAGGGAGTTTCCCAGGGGGAGGG + Intergenic
946095378 2:217270075-217270097 GAGGGTCTTTGGGAGGAGGATGG + Intergenic
947591685 2:231389389-231389411 CATGGCCTTTCCCAGGTGGAAGG - Intergenic
948396924 2:237651507-237651529 GAGGGAGCTTCCCAGATGGAAGG - Intronic
1169073931 20:2750202-2750224 GGGGGACTTTGCCCCGGGGAAGG - Intronic
1169771185 20:9202641-9202663 GAGGGACCTTGCCAGCTGACTGG + Intronic
1169816399 20:9661329-9661351 GAGAGACTTTGGGTGGTGGAGGG - Intronic
1171403939 20:24897161-24897183 AATGGAGGTTGCCAGGTGGAGGG + Intergenic
1172229432 20:33327007-33327029 GAGGGACTCAGCCCAGTGGAGGG - Intergenic
1172821995 20:37744666-37744688 GAGGGATTTTGCCATGGAGAAGG + Intronic
1173208435 20:41013026-41013048 AAGGCACTCTGCCAGGGGGAGGG + Intergenic
1174208223 20:48856683-48856705 GAGACTCTTTGCCGGGTGGATGG + Intergenic
1174577424 20:51546457-51546479 GAGTGACTCTGGGAGGTGGAGGG + Intronic
1174705984 20:52656566-52656588 GAGCCACTGTGCCTGGTGGAGGG + Intergenic
1174767713 20:53269451-53269473 GTGGGGCTTTGCAAGGTGGCTGG - Intronic
1174945192 20:54977421-54977443 GAGGAACTGTCCCAGTTGGAAGG - Intergenic
1175182383 20:57157667-57157689 GAGTGACCTTGCAAGGTGGAAGG + Intergenic
1175764157 20:61581521-61581543 GAGGGACCATCCCAGGAGGAGGG - Intronic
1177136319 21:17308534-17308556 GAGGGACTGTGCCATGAGGAAGG + Intergenic
1179953760 21:44726790-44726812 GAGTGCCTTTGCCTGCTGGAGGG + Intergenic
1180722413 22:17919446-17919468 CAGGGACTGTTCCAGGTGCAAGG - Intronic
1180927928 22:19568962-19568984 GAGAGACTTTTCCAGTTGCAAGG + Intergenic
1181458714 22:23073783-23073805 CAGGCACTGTGCCAGGTGCAGGG + Intronic
1181494269 22:23279218-23279240 GAGACACTATGCCAGGAGGAGGG - Intronic
1181535097 22:23537691-23537713 GCGGGACTTTGCCAAGGGGATGG + Intergenic
1181573527 22:23780488-23780510 GATCGACTTCGCCAGGTGAATGG + Exonic
1182194604 22:28503175-28503197 TAGGGAGTGTTCCAGGTGGAGGG - Intronic
1182782864 22:32881666-32881688 GATGGAATTTTCCAGGTTGAGGG + Intronic
1182868326 22:33624480-33624502 GAGGGAGTTTGCCAAGGTGAGGG + Intronic
1183201024 22:36386268-36386290 CAGGGACTCTGCCAGGTGGTGGG - Intronic
1183316009 22:37137263-37137285 GATGGGCTTTGACACGTGGAGGG + Intronic
1184272504 22:43392718-43392740 TAGGGACCTTGCCAGATGGTGGG + Intergenic
1185280692 22:49968680-49968702 CAGGGACCTGGCCAGGAGGATGG - Intergenic
1185323711 22:50215521-50215543 ATGGCACTGTGCCAGGTGGAGGG + Intronic
1185402730 22:50627116-50627138 GGGGGACTTTGGGAGGTGGGAGG + Intronic
949112884 3:284055-284077 TAAGTACTTTGCCAGGTAGAGGG + Intronic
949715434 3:6925274-6925296 GAGGGACTTTGCTAAGTGCCTGG - Intronic
950700647 3:14743460-14743482 GAGTGGCTTTTCCAGGTGCATGG + Intronic
953300916 3:41775060-41775082 CAGGGACGTTGTGAGGTGGAGGG + Intronic
956743282 3:72291520-72291542 GAGGGCCTTGGCCAGGTGTGTGG - Intergenic
961129094 3:124448714-124448736 GATGGTCTGTGCCAGGTGAAGGG - Intronic
962640193 3:137377498-137377520 GAGGGACTGTGCCATGAGGAAGG - Intergenic
963324169 3:143842929-143842951 GAAGGACTTTTGCAGCTGGAAGG + Intronic
967196374 3:187029865-187029887 GAGGAACAGTGACAGGTGGAAGG + Intronic
968574174 4:1357303-1357325 AAAGGACTGTGCCAGCTGGAGGG - Intronic
969158792 4:5237098-5237120 CAAGGAGTTTGCCAGGTGGGAGG + Intronic
969315071 4:6377067-6377089 GAGGGAGTTGGCCAGGTACAGGG + Intronic
971647623 4:29229536-29229558 GAGGGACTGTGCCATGAGGAAGG + Intergenic
974870118 4:67632079-67632101 GAGGGACATTGACAGGAGAATGG - Intronic
975306732 4:72857983-72858005 TAGGGAGTTTGCCAGATGGAAGG - Intergenic
977218978 4:94316331-94316353 GATAGACGTTGCCATGTGGAAGG - Intronic
978186126 4:105858619-105858641 GAGGGACTGTGCCGTGAGGACGG - Intronic
981014676 4:139961478-139961500 GTGGGACCTTGCCAGGATGATGG - Intronic
988767080 5:34389380-34389402 GAGGGACTGTGCCGTGAGGAAGG - Intergenic
990485960 5:56259495-56259517 AGGAGACTTTGCCATGTGGAAGG - Intergenic
990574693 5:57113052-57113074 CAGGTACTGTGCCAGGTGGTAGG - Intergenic
992166413 5:74056224-74056246 GAGGGACTTTCTCAGGTTAAGGG + Intergenic
993455224 5:88120172-88120194 GAGGGACTGTGCCGTGAGGAAGG + Intergenic
995836262 5:116402663-116402685 GAGGGTATTTGCTGGGTGGATGG + Intronic
996955081 5:129173643-129173665 CAGGGACTTTGCTAGGTGCTGGG + Intergenic
996987558 5:129585105-129585127 GAGGGACTGTGCCTTGAGGAAGG - Intronic
997732386 5:136191175-136191197 AAGGGAAGATGCCAGGTGGAAGG + Intergenic
998622145 5:143806692-143806714 GAAGGACTTTCCCAAGTGGGAGG - Intergenic
1000039200 5:157472548-157472570 GAGGGACAGTGCCAGGATGAGGG - Exonic
1000522873 5:162319234-162319256 GAGTGGCTTTTCCAGGTGTATGG - Intergenic
1002301053 5:178257448-178257470 TAGGGACTTCACCAGGTAGATGG + Intronic
1003483930 6:6558201-6558223 GATAGACTTTGACAGGTGAATGG - Intergenic
1003760381 6:9172844-9172866 AACGGAGGTTGCCAGGTGGAGGG + Intergenic
1004889336 6:20084245-20084267 GAGGAACTGTTCCAGGTTGAAGG - Intergenic
1005689356 6:28287270-28287292 GAGGGACTATGCCACCTGAATGG - Intronic
1006615989 6:35327260-35327282 GGGGGACATTTCTAGGTGGAAGG + Intergenic
1006638666 6:35477418-35477440 GAGGGGCTGGGCCAGGTGGAAGG - Intronic
1006734658 6:36264537-36264559 GAGGGAGTGTTCCAGGTTGAAGG - Intronic
1007575891 6:42925132-42925154 GAAGGACTTTCCCTGGAGGAGGG + Intronic
1008626904 6:53326006-53326028 TAAGGACTTTGCAGGGTGGAAGG + Intronic
1010895213 6:81353776-81353798 GAGCTACTTTGCAAGGTGAATGG + Intergenic
1012400825 6:98842124-98842146 CAGAGACTTTGGCAGGAGGATGG + Intergenic
1014000346 6:116358450-116358472 GATGGAATATGCCAGGTGTAGGG + Intronic
1014966722 6:127762599-127762621 GAAGAACCTTTCCAGGTGGAGGG - Intronic
1018056203 6:160054494-160054516 GATGGACGTTGTCAGGTGGTAGG + Intronic
1018247768 6:161838999-161839021 GAGGGACTGGGCGAGGTGGGGGG + Intronic
1019576225 7:1738983-1739005 GAGGGAGCTTCCCAGGCGGAGGG + Intronic
1020183650 7:5942141-5942163 GAAGGACTTTGGAAGGCGGAGGG - Intronic
1023786935 7:43717222-43717244 CTGTGACTTTTCCAGGTGGATGG - Intronic
1029155574 7:98515125-98515147 GAGAGACTTTTGCAGGTGTAGGG - Intergenic
1030463718 7:109873554-109873576 GAGGCACATTGCCAGGTCCATGG - Intergenic
1031929730 7:127672659-127672681 AAGGGAGTTTGCCGGTTGGATGG - Intronic
1031936512 7:127740709-127740731 GAGGAGCTTTGGAAGGTGGAGGG - Intronic
1032096565 7:128941139-128941161 GAGGGAGTTGGGCAGGTGAAGGG + Intronic
1033090291 7:138379291-138379313 TTGGGGTTTTGCCAGGTGGATGG - Intergenic
1035263570 7:157676328-157676350 GAGGGGCTGGGCCAGGTGGTGGG - Intronic
1035389351 7:158495415-158495437 GGGAGGCTTTGCCAGGTGCATGG - Intronic
1035632081 8:1115867-1115889 AGGGGACTGTGCCAGGTGTATGG + Intergenic
1036693841 8:10961826-10961848 GGGGAACGTTGCCAGGAGGAAGG + Intronic
1037566593 8:20123335-20123357 GAGGGGCTTTGGGAGGTGGGAGG - Intergenic
1038434033 8:27522251-27522273 GAGGGTCTGTGGCTGGTGGAGGG + Intronic
1039866345 8:41506986-41507008 GGGGGACTTGGCAAGGTGGAGGG - Intronic
1039900010 8:41744960-41744982 GAGGGCCTATTCCAGATGGAAGG + Intronic
1039923397 8:41908431-41908453 GAGGGAATGTGCCAGGCAGAGGG - Intergenic
1041433693 8:57814480-57814502 CTGGGACATTGCCAGGTGGCAGG - Intergenic
1043851398 8:85220483-85220505 GCGGGACTACGCCAGGTGGGTGG - Intergenic
1044835048 8:96287613-96287635 GAGTGACATTGACAGGTGCAGGG - Intronic
1045098591 8:98823972-98823994 GAGAGAGTTTGCCACATGGAAGG - Intronic
1045201371 8:99985381-99985403 GAGGGAGTTTGCCAGTTGGAAGG - Intronic
1045373626 8:101549797-101549819 GTAGGAATTTGTCAGGTGGATGG - Intronic
1046154380 8:110268078-110268100 GAGGGCCTTTGCCACTGGGAAGG - Intergenic
1047141953 8:122151498-122151520 GAAGAAATGTGCCAGGTGGAGGG - Intergenic
1047556872 8:125941472-125941494 TTGGGACTTAGCCAGTTGGAGGG + Intergenic
1047847059 8:128817893-128817915 CACGGACTTTGCCAAGTGTAAGG + Intergenic
1048950148 8:139489889-139489911 CAGGGGCTTTGTCAGGGGGAAGG - Intergenic
1049178135 8:141206463-141206485 GAGGGACTTTGATAGTTGGGGGG - Intergenic
1050794253 9:9517172-9517194 GAGGCACTGTGCCAGGTGAAGGG + Intronic
1051433013 9:16999582-16999604 AAAGGAGTTGGCCAGGTGGAGGG - Intergenic
1052638587 9:31134514-31134536 TAGGGACTTGGGGAGGTGGAAGG + Intergenic
1052864257 9:33455465-33455487 GAGGCACTTTGGGAGGTGGGTGG + Intergenic
1053132082 9:35621342-35621364 GATAGAATTTGCCATGTGGAAGG + Intronic
1053366300 9:37524810-37524832 GAGGGATTTGGACAGGTGGTTGG + Intronic
1057727681 9:97579772-97579794 GATGGACTCTGCCAGGTGTAGGG + Intronic
1057916017 9:99055785-99055807 GAGAGATTTTTCCAGGTGAAAGG + Intronic
1059929742 9:119249131-119249153 CAGGGAGTTTGCCCGTTGGAAGG - Exonic
1060529606 9:124340470-124340492 GAGGGGCTCAGCCAGGTGGATGG - Intronic
1060730087 9:126031508-126031530 GATGGACTCTGCCAAGTGAAAGG - Intergenic
1060739883 9:126091172-126091194 GAGGTACTTTGATCGGTGGAAGG - Intergenic
1060847606 9:126849631-126849653 GGGGGATTCTGCCGGGTGGAAGG + Intergenic
1060850319 9:126869502-126869524 GAGTGACTCTGCCAAGTAGAGGG + Intronic
1061224938 9:129275927-129275949 CAGGGGTTCTGCCAGGTGGATGG - Intergenic
1061280142 9:129593327-129593349 GAGGGAATTTCCCAGGTGGCAGG + Intergenic
1061304577 9:129724905-129724927 GAGGGGATTTGCTTGGTGGAGGG + Intergenic
1062076627 9:134593303-134593325 GAGAGGCTTCTCCAGGTGGAGGG - Intergenic
1185611963 X:1398398-1398420 GAGGGAGTCCCCCAGGTGGAAGG - Intergenic
1189311792 X:40024214-40024236 GATGGAGGTTGCTAGGTGGAGGG + Intergenic
1189436605 X:40998359-40998381 GAGAGAGGTTGGCAGGTGGATGG - Intergenic
1190310903 X:49116440-49116462 GGGGCACTTTGGCAGGTGGGAGG - Intronic
1190515111 X:51215762-51215784 TTGGGACCTTTCCAGGTGGAGGG - Intergenic
1190749416 X:53348223-53348245 GAGGGACTCTTCCATATGGAAGG + Intergenic
1191116386 X:56857518-56857540 GTGTGACTTTTCCAGGTGCATGG + Intergenic
1193721122 X:84989052-84989074 GAGGGACTGCTCCAGGTTGAAGG - Intergenic
1195729519 X:107951895-107951917 GAGGTACTTTGGGAGGTGGGCGG + Intergenic
1197752287 X:129973483-129973505 AAAGGATTTGGCCAGGTGGAGGG + Intergenic
1198518932 X:137433316-137433338 GAGGGACAGTGCCATGAGGAAGG + Intergenic
1199527491 X:148808707-148808729 CAGGGACTTTTCCATGTAGAAGG + Intronic