ID: 1122844554

View in Genome Browser
Species Human (GRCh38)
Location 14:104485468-104485490
Sequence GCTATTGCATAGCCATGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122844553_1122844554 -10 Left 1122844553 14:104485455-104485477 CCAATTAGTGTTGGCTATTGCAT 0: 1
1: 0
2: 3
3: 14
4: 95
Right 1122844554 14:104485468-104485490 GCTATTGCATAGCCATGCTGTGG 0: 1
1: 0
2: 2
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122844554 Original CRISPR GCTATTGCATAGCCATGCTG TGG Intronic