ID: 1122844554

View in Genome Browser
Species Human (GRCh38)
Location 14:104485468-104485490
Sequence GCTATTGCATAGCCATGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122844553_1122844554 -10 Left 1122844553 14:104485455-104485477 CCAATTAGTGTTGGCTATTGCAT 0: 1
1: 0
2: 3
3: 14
4: 95
Right 1122844554 14:104485468-104485490 GCTATTGCATAGCCATGCTGTGG 0: 1
1: 0
2: 2
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122844554 Original CRISPR GCTATTGCATAGCCATGCTG TGG Intronic
901134701 1:6985351-6985373 CCTCTTGCAAAGCCAGGCTGTGG - Intronic
902713958 1:18259802-18259824 GCCATTGCCTACACATGCTGTGG - Intronic
909093561 1:71257775-71257797 GCTAGTGCATATCCCTGATGTGG - Intergenic
915363922 1:155303112-155303134 GCTACTGCACATCCTTGCTGTGG - Intergenic
916412534 1:164559840-164559862 GCTGATGCATTCCCATGCTGGGG + Exonic
920801406 1:209191145-209191167 ACTATGGCAGAGCCATGTTGAGG + Intergenic
922786289 1:228283895-228283917 GCTCATTCACAGCCATGCTGGGG - Intronic
923290702 1:232542711-232542733 CCTAGTGCATAGCCAGCCTGAGG - Intronic
1063062097 10:2566610-2566632 GCTATTTCTTACCCATCCTGTGG - Intergenic
1066129266 10:32375071-32375093 TCTTTTGCAAAACCATGCTGAGG + Intronic
1067478620 10:46581665-46581687 GGCATTGCATGGCCAGGCTGGGG - Intronic
1067616117 10:47760136-47760158 GGCATTGCATGGCCAGGCTGGGG + Intergenic
1070775897 10:79109621-79109643 GCGAGTGCATAGGCATGGTGGGG - Intronic
1076459641 10:130632811-130632833 GGTCTTGCTTAGCTATGCTGTGG - Intergenic
1083118307 11:60486175-60486197 CCTTTTGAAAAGCCATGCTGTGG + Intergenic
1087374739 11:97326697-97326719 GCTTTTGCATAGGGCTGCTGTGG + Intergenic
1092438611 12:8475672-8475694 GCTAATGCATACCCACACTGGGG + Intronic
1097994391 12:65871820-65871842 GCTATTGCCAAGCCTTTCTGAGG - Intronic
1098260836 12:68668923-68668945 CCTATTTCATAGCATTGCTGAGG - Exonic
1100270442 12:93019638-93019660 GACAGTGCAGAGCCATGCTGAGG + Intergenic
1105479121 13:20757074-20757096 GCTATAACACAGCCAAGCTGGGG + Intronic
1105702918 13:22947230-22947252 GCTAGTGCATAGCAGTGCTGTGG + Intergenic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1106810216 13:33351178-33351200 TCCATTGCATAGCCATTATGAGG + Intergenic
1116109627 14:40560960-40560982 GCTTTTGCTTAGCCTTGCTTTGG + Intergenic
1119259062 14:73226451-73226473 GCTAGTGCATCTCCATGCAGGGG + Intergenic
1122844554 14:104485468-104485490 GCTATTGCATAGCCATGCTGTGG + Intronic
1130845626 15:87741747-87741769 GCTAGGGCAGAGCCATACTGTGG + Intergenic
1138969524 16:62128088-62128110 AATATTGCCTAGCGATGCTGGGG + Intergenic
1151364978 17:73611422-73611444 GCTATGGCATAGCAAGGCTGGGG + Intronic
1152027115 17:77817469-77817491 GTTATGGCACAGCCATGCAGTGG + Intergenic
1155597973 18:27510456-27510478 GCCATTGCCTAGCCTTGCTTAGG + Intergenic
1156154676 18:34287683-34287705 GGTACTGCCTAGCAATGCTGTGG - Intergenic
1156816890 18:41322084-41322106 GCAATAGCACAGCCATGCAGTGG - Intergenic
1162013811 19:7832831-7832853 GCTGTCGGATAGCCATGCTGAGG + Intronic
924964269 2:60521-60543 GCTATGGCATGGCTTTGCTGGGG - Intergenic
927876658 2:26660788-26660810 GCTATGGTATATCCATACTGTGG - Intergenic
928986960 2:37191390-37191412 GCTATAACATAGGCAGGCTGGGG - Intronic
930153116 2:48078259-48078281 GCTAATGCACAGCCATGGTTGGG - Intergenic
934521532 2:95023079-95023101 GCCATTGCAGAGCCAGCCTGGGG - Intergenic
935064263 2:99634333-99634355 GCTATGGCAGAGCTAAGCTGTGG + Intronic
936026443 2:109034459-109034481 AGTATTGCAGAGCCAAGCTGAGG + Intergenic
936559928 2:113528611-113528633 GCTATTGCATGTGCATTCTGGGG - Intergenic
1170975255 20:21157972-21157994 GCTATTGCACAGCCACTCTGAGG + Intronic
1179226092 21:39454776-39454798 GCTATTTTATAACAATGCTGAGG - Intronic
1180135462 21:45859388-45859410 TCTGATGCATAGCCATGCAGGGG - Intronic
1181405762 22:22684144-22684166 GTCATGGCCTAGCCATGCTGAGG - Intergenic
951129590 3:19025950-19025972 GCTACTACATACCCTTGCTGTGG + Intergenic
952625527 3:35398365-35398387 TCTAATGCATAGCAATACTGAGG - Intergenic
957004334 3:74926828-74926850 GTTATTTCATAGCTATGCCGAGG + Intergenic
960195143 3:114756996-114757018 GCTATTGGTTGCCCATGCTGAGG - Intronic
960326978 3:116309222-116309244 CCCATTTCATAGACATGCTGAGG + Intronic
963723242 3:148888432-148888454 GCTACAACCTAGCCATGCTGGGG + Intronic
964423077 3:156524908-156524930 GCTATTGCCTAGTGATGTTGTGG + Intronic
968706797 4:2082330-2082352 GCTTTTGCAAAGCCATGTGGAGG + Intronic
976132115 4:81895916-81895938 TCTATTCCTTAGCCATGTTGGGG - Intronic
976349286 4:84042630-84042652 GCTATAACATAGCCATGCTGTGG + Intergenic
978455623 4:108887297-108887319 TCCATTGCAGAACCATGCTGGGG - Intronic
986154627 5:5162389-5162411 GAGATCCCATAGCCATGCTGTGG - Intronic
986301038 5:6478685-6478707 GCTATGGCCCAGCCTTGCTGCGG - Intronic
988514926 5:31895968-31895990 GCTATTGCATAGTGTGGCTGGGG - Intronic
996317996 5:122182862-122182884 GCATGTGCATAGGCATGCTGGGG + Intergenic
999307016 5:150526054-150526076 GCTATTCCTTGGTCATGCTGAGG + Intronic
1002818106 6:697491-697513 GCAGCTGCATAACCATGCTGTGG + Intergenic
1008567255 6:52781524-52781546 CCCATGGCATACCCATGCTGGGG - Intergenic
1008570690 6:52813844-52813866 CCTATGGCATACCCATGCTGGGG - Intergenic
1018796515 6:167189696-167189718 GCTATTACATGGCCACCCTGTGG + Intronic
1018819805 6:167365421-167365443 GCTATTACATGGCCACCCTGTGG - Intronic
1019762967 7:2827566-2827588 GCTTCTGCATAACCACGCTGAGG + Intronic
1024063901 7:45717599-45717621 GCCCTTGCTTGGCCATGCTGTGG + Exonic
1026451080 7:70530201-70530223 GCAAATGCATATCCGTGCTGGGG + Intronic
1031617144 7:123894945-123894967 GCCATTGCCTAGCCTTGCTTAGG + Intergenic
1031979350 7:128114703-128114725 GCTATTCCAAAGGCATGGTGGGG + Intergenic
1033468156 7:141616683-141616705 GCTATTCATTAGCCATCCTGAGG + Intronic
1040652753 8:49467188-49467210 GCCAATGCATAGCCAGGATGAGG + Intergenic
1041889948 8:62858098-62858120 GCTGTTGCATAGGGCTGCTGTGG + Intronic
1042718731 8:71804312-71804334 GCTGTTGGAGAGCCATGTTGTGG + Intergenic
1049345191 8:142134954-142134976 GCTCTTGCCTAGTCATTCTGGGG - Intergenic
1049892938 9:87753-87775 GCTATTGCATGTGCATTCTGGGG + Intergenic
1057263173 9:93597576-93597598 GCCAAGCCATAGCCATGCTGTGG - Intronic
1057859755 9:98631026-98631048 TCTACTGCATAGCGCTGCTGGGG + Intronic
1060744930 9:126125075-126125097 GCTCTCGTATAGCCGTGCTGTGG + Intergenic
1203774836 EBV:67096-67118 TCTACAGCATAGCCCTGCTGCGG + Intergenic
1187245568 X:17550453-17550475 GCTATTGCTTAGCCATGGGGTGG + Intronic
1187478429 X:19632616-19632638 GCTATTGCATCTCTTTGCTGAGG - Intronic
1187511918 X:19927514-19927536 GCTATTGAATAGCCCAACTGTGG - Intronic
1188565146 X:31518638-31518660 GTTTTTGCAGAGCCATGATGAGG + Intronic
1189562707 X:42207715-42207737 GCCATTGCCTAGGCTTGCTGAGG - Intergenic
1189597975 X:42590106-42590128 GCTATTGCCCAGGCTTGCTGAGG + Intergenic
1197425767 X:126295715-126295737 CCTATTGCATAGTCATTCTAAGG + Intergenic
1198128285 X:133669098-133669120 GCTATTTAATAGCCATACTTTGG + Intronic
1201943433 Y:19483892-19483914 GCTATTGGAGAGCCTCGCTGTGG + Intergenic