ID: 1122847621

View in Genome Browser
Species Human (GRCh38)
Location 14:104509337-104509359
Sequence CTTTGGATAAATAGCTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122847621 Original CRISPR CTTTGGATAAATAGCTAGGA GGG (reversed) Intronic
902081788 1:13826141-13826163 TCTTGGATATATAGCTAGGAGGG + Intergenic
902843705 1:19092859-19092881 CTTAGGATAAATGGCAAGGCTGG + Exonic
907086421 1:51679263-51679285 GTTTGGCTTAATAGCTAGCAAGG + Intronic
908700024 1:66888965-66888987 GTTTGGAAAAATAGATTGGAAGG + Intronic
908734252 1:67259271-67259293 CCTTGGATAAATACCTAGGTAGG + Exonic
909247661 1:73308717-73308739 ATCTGGGTAAATACCTAGGAGGG - Intergenic
909987129 1:82174724-82174746 CTTTGGATACATATCAAGTAGGG - Intergenic
909989609 1:82207102-82207124 GCTTTGATAAATACCTAGGAGGG - Intergenic
910811941 1:91247084-91247106 CTTTGGGTATATACCTAGTAAGG + Intergenic
910816227 1:91293690-91293712 CTTTGGGTATATACCTAGTAAGG - Intronic
912034228 1:105291151-105291173 CTTTGGATATATACCCAGTAAGG + Intergenic
913373405 1:118125873-118125895 CTTTGGATAAATACCTAATAGGG + Intronic
914830180 1:151165431-151165453 TTGTGGATAAGTAGCTTGGAGGG - Exonic
916748238 1:167700933-167700955 CTTTGGTTGAAAAGCTAGTAGGG + Intronic
917065969 1:171093687-171093709 CTTTGGATAGATATCTACTAGGG + Intronic
918851122 1:189692347-189692369 CTTTGGATAAATTTCTAGCCTGG + Intergenic
919121484 1:193346203-193346225 CTTTGGAAAAACAGCTGGCAAGG + Intergenic
919189915 1:194203227-194203249 CTTTGGATCATCAGCTGGGATGG - Intergenic
919557031 1:199070388-199070410 CCTTGAATAAATATTTAGGATGG - Intergenic
919561826 1:199130361-199130383 CTCTGGATAAATAGTTAATATGG - Intergenic
921775437 1:219094146-219094168 CTTTGGATAAATATTCAGAAGGG - Intergenic
922220350 1:223553499-223553521 CTCTGAATAAAAAGCTGGGATGG - Intronic
923424199 1:233852706-233852728 CTTTGGGTAAATATCAAGGAGGG - Intergenic
923758866 1:236820656-236820678 ATTTGGGTAAATAGCAAGGAGGG + Intronic
923810179 1:237306219-237306241 CTTTGGATTAATTTTTAGGATGG - Intronic
1062869361 10:886438-886460 CTTTGGATAAATACTCAGAAAGG - Intronic
1063086683 10:2824917-2824939 CTTTAAATACATAGCTAGTATGG - Intergenic
1064627175 10:17273296-17273318 CTTTGGATAGACAACCAGGAGGG + Intergenic
1065258823 10:23903395-23903417 CTTTGGTTAAATAGGTATGATGG - Intronic
1065561263 10:26966123-26966145 CTTTGGATATATACCCAGAAAGG - Intergenic
1066453836 10:35555344-35555366 CTTTAAATAAAAAGATAGGAGGG + Intronic
1067008688 10:42690543-42690565 CTTTGGAGCAGTAGGTAGGAGGG - Intergenic
1068001732 10:51342897-51342919 CCTTGGATTAAAAGTTAGGAGGG + Intronic
1068401277 10:56530854-56530876 CTCTGGATAATAAGCTAGGCAGG - Intergenic
1068550010 10:58396944-58396966 CATTGGTGAAATAGATAGGATGG + Exonic
1070663925 10:78330132-78330154 CTTTGGGAAAAAAGCCAGGAGGG - Intergenic
1073833465 10:107413660-107413682 TTTGGGATAAAGAGCTTGGAGGG + Intergenic
1074057104 10:109932585-109932607 TCTTGGATAAATACCTAGGATGG + Intergenic
1075290337 10:121224494-121224516 CTTTGGAGCAAGAGCCAGGAGGG - Intergenic
1075696641 10:124440821-124440843 CTTTGGTAAAATATCTAGGCCGG - Intergenic
1078172657 11:8940546-8940568 CTAAGGACACATAGCTAGGAAGG - Intergenic
1079416700 11:20244640-20244662 CTCTGCATTAATATCTAGGAAGG - Intergenic
1079807341 11:24950004-24950026 ATTTGGCTAAATTACTAGGAGGG + Intronic
1080134654 11:28840747-28840769 GTTTGGATAAATATGAAGGAGGG + Intergenic
1081208711 11:40305421-40305443 TTTTGAATGAATAGCTAAGATGG + Intronic
1082023747 11:47556117-47556139 CTTAGGATAAATTCCTAGAAAGG - Intronic
1086382389 11:86269998-86270020 CTCTGGGTAAATGCCTAGGAGGG + Intronic
1086875021 11:92085363-92085385 CTTTGGTTATATGCCTAGGAGGG + Intergenic
1087124505 11:94610348-94610370 CTTTGGATATATAGCCAGAGTGG + Intronic
1087201964 11:95354668-95354690 CTTTGGATAAATAACAAGTATGG + Intergenic
1089039199 11:115430071-115430093 CTTTGGAAAAATAACTTGTAAGG + Intronic
1091532011 12:1367159-1367181 AATTGGTTAAATAACTAGGAAGG + Intronic
1092212302 12:6654705-6654727 GTTTGGAGCAATATCTAGGATGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093052910 12:14523795-14523817 CTTTGGATAAATACCCAGCAAGG - Intronic
1093064071 12:14638357-14638379 CTTTGGATAAATACTCAGCAGGG - Intronic
1093606664 12:21098668-21098690 CTTTGGATAAATTCCCAGTAGGG + Intronic
1094310772 12:29079495-29079517 CTCTGGATAAATATTTAGGTAGG - Intergenic
1094438369 12:30447148-30447170 CTTTGAATAAATGGCTTAGAGGG - Intergenic
1097031377 12:56092609-56092631 CCTTGGAGAAATGGCTGGGATGG - Intronic
1097567695 12:61291843-61291865 CTTTGGAGTAATAGCTAGTCTGG - Intergenic
1098096195 12:66958809-66958831 CTTAGGATAAATTGCTAGAATGG + Intergenic
1101649496 12:106662064-106662086 CTTTGGGTAAATACCAAGAAGGG + Intronic
1102627400 12:114246272-114246294 CTATGGATATATAGTTTGGAGGG - Intergenic
1106971671 13:35147833-35147855 GTTTTGATAAAGAGCTATGAAGG + Intronic
1107663938 13:42669686-42669708 CTTTGGAAAAATATCAAGGAAGG - Intergenic
1109269376 13:60237343-60237365 CTTTTGATACTTAGCTAGCAAGG + Intergenic
1109536748 13:63731963-63731985 CTGTTAATAAATAGCTAGGATGG - Intergenic
1109584477 13:64380630-64380652 CTTTGGATAAATACTCAGTAAGG + Intergenic
1109897043 13:68706407-68706429 CTTTGGATATATACCCAGTAAGG + Intergenic
1110512549 13:76368248-76368270 CTTTGGATAAATATCTATTCAGG - Intergenic
1111647362 13:91047512-91047534 CTTTCTATAAGTAGCCAGGATGG - Intergenic
1111697608 13:91644709-91644731 CTTTTTAATAATAGCTAGGAAGG - Intronic
1112701572 13:102015716-102015738 CTTTGGAAAAATAGCACAGAAGG - Intronic
1112794555 13:103041951-103041973 CCTTGGGTAAATACCTAGGAGGG + Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1114003960 14:18291746-18291768 CTTTTAATAAATAACTAGGGAGG - Intergenic
1115261684 14:31461043-31461065 ATTTGGATGAATAGCTATGCTGG + Intergenic
1115724982 14:36203936-36203958 TTTTGGATAAATACCCAGAATGG - Intergenic
1115891542 14:38035296-38035318 CTTTGAATAAAAATCTAGAAAGG - Intronic
1117607622 14:57446318-57446340 ATTTGGGTAAATACCAAGGAAGG + Intergenic
1119178837 14:72590276-72590298 TCTTGGTTAAATACCTAGGATGG - Intergenic
1119692449 14:76686676-76686698 CCTTGAATAAATATCTAGGAGGG + Intergenic
1120742420 14:88122705-88122727 CTTTGGGTATATACCTAGTAAGG + Intergenic
1122847621 14:104509337-104509359 CTTTGGATAAATAGCTAGGAGGG - Intronic
1123388425 15:19843966-19843988 CTTTTAATAAATAGCTAGGGAGG - Intergenic
1124717370 15:32077297-32077319 CTTTGGGTAAATACCAAAGAGGG + Intronic
1124724068 15:32139363-32139385 CTTTGGATAAATACAAGGGAAGG + Intronic
1125417035 15:39464907-39464929 CATTGAATAGATAGCTTGGATGG - Intergenic
1125456485 15:39865190-39865212 CTTTGGGTAGATACCTAGTAGGG - Intronic
1125956678 15:43795205-43795227 CTTTGGTTACACAGCTATGAGGG - Exonic
1127178366 15:56385937-56385959 TCTTGGGTAAATATCTAGGAAGG - Intronic
1128172742 15:65527309-65527331 CTTGGAATAAATACCTATGAAGG - Intergenic
1131360792 15:91788899-91788921 CTTTGGAGAAATAGACATGAGGG - Intergenic
1133803368 16:9103282-9103304 CTTTGGAAAAATGGTTAAGAGGG + Intronic
1137740644 16:50769260-50769282 CTTTGGAAACACAGCTTGGAAGG - Intronic
1137999283 16:53257577-53257599 TTTTGCTTAAGTAGCTAGGAGGG + Intronic
1138721159 16:59082025-59082047 CTTTGGGTATATACCCAGGAAGG - Intergenic
1138952174 16:61926467-61926489 CTTTAGAAAAATAGCTAACAAGG - Intronic
1140248115 16:73269657-73269679 TTTTGGGTAGATACCTAGGAGGG + Intergenic
1141037086 16:80636694-80636716 CTTTGGGTATATACCCAGGATGG - Intronic
1142725162 17:1808128-1808150 CTTAGGATAAATTCCTAGAAGGG - Intronic
1143690825 17:8563716-8563738 CTTTTGATAAATAGATATGAGGG + Intronic
1144009381 17:11131835-11131857 TTTTGGATATATATCTAGTAGGG + Intergenic
1144087659 17:11825373-11825395 CAGAGGATAAATAGATAGGAGGG - Intronic
1148663111 17:49352623-49352645 TTGTGGGTAAATACCTAGGAGGG - Intronic
1149090693 17:52774648-52774670 CTTTGGGTATATACCTAGTAAGG + Intergenic
1149518440 17:57299399-57299421 CTTTAAATCAAAAGCTAGGAAGG - Intronic
1149884065 17:60323135-60323157 CTTTGGATATATACCTTGCATGG - Intronic
1153054219 18:929598-929620 CTTTTGATAAATAGTTATTAAGG - Intergenic
1153106902 18:1538039-1538061 CTTTGGAGAAATAGCTATCCAGG + Intergenic
1153585896 18:6619911-6619933 CTTTGGATAAATACCCAAGCAGG - Intergenic
1153775280 18:8447845-8447867 GTTTGGTTAATTTGCTAGGAAGG + Intergenic
1154231566 18:12560224-12560246 TTTTGGGTATATAACTAGGAGGG - Intronic
1154396148 18:13991221-13991243 ATTTGGATAAATACCCAGTATGG - Intergenic
1154533816 18:15376066-15376088 CTTTTAATAAATAACTAGGGAGG + Intergenic
1155553225 18:26989562-26989584 CTTGGGAAAAATGCCTAGGAAGG - Intronic
1156580423 18:38368596-38368618 CTTTTTATAAATTGCTAAGAAGG - Intergenic
1156964353 18:43072585-43072607 CTCTTGCTAAGTAGCTAGGATGG + Intronic
1157960944 18:52152648-52152670 ATTTGGATAAATGGCTATGTAGG - Intergenic
1158151097 18:54371491-54371513 TTTTGGATATATACCTAAGAGGG + Intronic
1160199617 18:76785713-76785735 CTTTCAGTAAATACCTAGGAGGG - Intergenic
1168628703 19:57939696-57939718 CTTTGGATAAATTCCCAGTAGGG - Intergenic
925354208 2:3226140-3226162 CTTTGGATATATACCCAGAATGG + Intronic
925376912 2:3392822-3392844 CTTTGGATACATACCCAGAATGG - Intronic
927493097 2:23533365-23533387 CTTTGGAAAGAAAGCTGGGATGG + Intronic
928008727 2:27587064-27587086 CTTTTGATAAATATCTAAGATGG + Intronic
928493957 2:31813019-31813041 CTTTGGATAAAACGCTGAGATGG + Intergenic
928567133 2:32564467-32564489 CTTTGGTAATATACCTAGGATGG + Intronic
929446635 2:42007130-42007152 TTTTGGATGAATTCCTAGGATGG - Intergenic
929654306 2:43715337-43715359 CTTTGGAGAAAAAGCTAGAGGGG + Intronic
930302254 2:49631401-49631423 CTTAGGCTAAGTAGCTAGGCAGG - Intergenic
931307092 2:61040227-61040249 CTTTGGATATATACCCAGTAAGG - Intronic
932946787 2:76243246-76243268 CTTTGGATAAATACTCAGTATGG + Intergenic
934530213 2:95081368-95081390 TCTTGGATACATACCTAGGAAGG + Intergenic
935091154 2:99896178-99896200 TTCTGGATAAATAACTAGGGAGG + Intronic
936000904 2:108829329-108829351 CTTTGGAGAAATAGCTATTTAGG - Intronic
936528137 2:113256142-113256164 CTTTGTTGAAATACCTAGGAAGG - Intronic
938166404 2:129031031-129031053 TTTTAGATATATAGCTGGGAGGG - Intergenic
938532564 2:132203362-132203384 CTTTTAATAAATAACTAGGGAGG + Intronic
939370766 2:141297206-141297228 CTTTGGGTATATACCTAGTAAGG + Intronic
940082915 2:149825078-149825100 ATTTGGATATATAGTTAGCAAGG + Intergenic
940163883 2:150746309-150746331 CTTTGGGTAAATATCAAGAAGGG - Intergenic
940669170 2:156646563-156646585 CTTTGGGTAAATATCCAGTATGG - Intergenic
941437841 2:165493447-165493469 GTTTGGATAGATAACTTGGAAGG - Intronic
941844982 2:170123432-170123454 ATTTGCATTAATAGCAAGGAAGG - Intergenic
943498973 2:188662432-188662454 ATTTGGATATATACTTAGGAGGG + Intergenic
944016680 2:195048626-195048648 TTTTGGCTAAATAGCTGGGAAGG - Intergenic
945018730 2:205549279-205549301 CTTTGGGTAAATACTAAGGAAGG - Intronic
945765611 2:213973251-213973273 CTTGGGAGAAAAAGCCAGGAAGG - Intronic
946083564 2:217148990-217149012 AGTTGGATAAATGGCTAAGAGGG - Intergenic
946662077 2:222012174-222012196 CTTTGGATATATATCAAGAAGGG + Intergenic
946921120 2:224583624-224583646 CTTTGTGTAAATAGGTACGATGG - Intronic
947376368 2:229500522-229500544 CTTTGGATATATATCCAGTAGGG - Intronic
948493328 2:238328086-238328108 TTTTGGATAAATACCCAGAAGGG + Intronic
1168761877 20:354839-354861 CTTTCAATAAACAGCTGGGATGG + Exonic
1169304634 20:4477928-4477950 CTTTGGAGAAATAGCTATTCAGG - Intergenic
1169733499 20:8812124-8812146 CTTTGGGTATATAGCAAGCAAGG - Intronic
1170112404 20:12819967-12819989 CTTTGGATGTATAACTAGAAGGG - Intergenic
1170224801 20:13980626-13980648 CTTTGGATATATACCTAGAGGGG - Intronic
1170254311 20:14322878-14322900 ATATGGAAACATAGCTAGGAAGG + Intronic
1170385562 20:15812380-15812402 CTTTGAATAAATATGGAGGACGG + Intronic
1170867343 20:20170813-20170835 ATGTGGAAAGATAGCTAGGATGG + Intronic
1173692454 20:44973492-44973514 CTTAGGGAAAATAGCAAGGATGG - Intronic
1173707969 20:45127022-45127044 TTTTGGATAAATACCCAGAAGGG + Intergenic
1174986839 20:55463765-55463787 ACTTTGATAAATACCTAGGATGG + Intergenic
1175410796 20:58767012-58767034 GTTTGGGTAAATATATAGGAGGG + Intergenic
1175519758 20:59592998-59593020 CTTTGTGTAAATACCAAGGAAGG + Intronic
1176727576 21:10453151-10453173 CTTTGGATACAAAGATAGTATGG + Intergenic
1180286818 22:10753880-10753902 CTTTGGATACAAAGATAGTATGG - Intergenic
1180428476 22:15222549-15222571 CTTTTAATAAATAACTAGGGAGG - Intergenic
1180511084 22:16090893-16090915 CTTTTAATAAATAGCTAGGGAGG - Intergenic
1180845229 22:18977406-18977428 TCTTGGGTAAATACCTAGGAGGG - Intergenic
1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG + Intronic
1185091273 22:48776071-48776093 CTTTTGATAAAAAGCAAGAAAGG - Intronic
950092966 3:10310124-10310146 CTTTGGAGAAATGACCAGGAGGG - Intronic
950476152 3:13216128-13216150 CTTTGGATAGATTCCTAGAATGG - Intergenic
952006339 3:28846510-28846532 CTTGGGATAAATACCTCTGAGGG - Intergenic
953753335 3:45626231-45626253 ATTTGGGTAAATACCAAGGACGG - Intronic
954949272 3:54455094-54455116 CTTTGGATATATACCCAGTAGGG + Intronic
955868166 3:63407992-63408014 CTTTAGAAAACTAGCTAGCATGG + Intronic
958593049 3:96184652-96184674 TTTTGGATAAATACCCAGAATGG - Intergenic
958985283 3:100773586-100773608 CTTTGGACAAATACCTAGGAAGG - Intronic
959738540 3:109689226-109689248 TTTTGGATATATACCGAGGATGG + Intergenic
960032281 3:113066442-113066464 CTTTGTAGAATTAGCTAGGGAGG + Intergenic
960492107 3:118329851-118329873 CTTTGGATATATACCCAGAATGG - Intergenic
960607482 3:119522048-119522070 CTTTGGATAAATACCTAGTAGGG - Intronic
960969142 3:123126747-123126769 ATTTGGAGAATTAGCTAGGCTGG - Intronic
961187083 3:124924969-124924991 CTTTGGTTAAATACCAAGGAGGG - Intronic
961189375 3:124945156-124945178 CTTGGGATAAATTCCTAGAATGG - Intronic
961863301 3:129935184-129935206 CTTTGGAGAAATGTCTAGGGAGG - Intergenic
962366587 3:134790214-134790236 CTTTAAAGACATAGCTAGGAAGG - Intronic
962553567 3:136523068-136523090 CTTTGGATAGATACCCAGTAAGG + Intronic
962911052 3:139850035-139850057 CTTTGGATATATACCCAGTAAGG + Intergenic
964152414 3:153543275-153543297 CTTTGGATAGATAGCTGGATTGG + Intergenic
964341644 3:155714511-155714533 CTTTGTGTACATAGCTGGGAGGG - Intronic
964689946 3:159438990-159439012 CTTTGGATATATACCCAGTAAGG + Intronic
965526432 3:169724187-169724209 CTTTGGAAAAATACCAAGAAGGG - Intergenic
965891153 3:173515005-173515027 TTTTGGATAAATACCCAGAATGG + Intronic
965956369 3:174375618-174375640 CTTTAGGTAAATAGGCAGGAGGG - Intergenic
966010356 3:175067730-175067752 TTTTGGATATATACCTAGTAGGG - Intronic
966339710 3:178912160-178912182 CTTTGGGTATATACCTAGTAAGG - Intergenic
968255082 3:197262486-197262508 GTTTGGTTAATTTGCTAGGATGG - Intronic
971301570 4:25446434-25446456 ATTTGGAGAAATAACTTGGAGGG + Intergenic
971656420 4:29351871-29351893 CTTTGGGTATATAGCCAGTAGGG + Intergenic
972222381 4:36970573-36970595 TTTTGGATATATACCCAGGATGG - Intergenic
972881719 4:43432585-43432607 CCTTGGATAAACAGTAAGGAGGG - Intergenic
973143238 4:46794402-46794424 CTTTGGTTTAATATATAGGAAGG + Intronic
973661523 4:53112063-53112085 CTGTGGATACAGAGCTAGGCCGG + Intronic
974622580 4:64379903-64379925 CATTGGATAAATACCCAGGGTGG + Intronic
974861598 4:67528820-67528842 TTTTGGGTATATACCTAGGAGGG + Intronic
975752934 4:77542873-77542895 CTTTGTAGAATTAGTTAGGAAGG + Intronic
976345806 4:83998867-83998889 ATTTGGATAAATATCTACAATGG - Intergenic
976467352 4:85386150-85386172 CTCTAGATAAATTGCTAAGATGG + Intergenic
977063589 4:92286490-92286512 CTTTGGATATATACCCAGTAGGG + Intergenic
977547416 4:98400204-98400226 CTTTTGATAAATACCCAGTAAGG - Intronic
977641403 4:99361521-99361543 CTTAGTAGAAATAGCAAGGAAGG + Intergenic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
978584984 4:110267713-110267735 CTTTGGGTAAATATCAAGGAGGG - Intergenic
979346483 4:119593214-119593236 TTTTGGGTAAATACATAGGAGGG - Intronic
981397069 4:144264200-144264222 CTTTGGATATATAACCAGCAGGG - Intergenic
981720158 4:147793527-147793549 TTTTGGCTAAATAGCTATGCGGG - Intronic
984551470 4:181164973-181164995 CTTTTAATAAATAACCAGGACGG + Intergenic
985793132 5:1942529-1942551 TTTTGGATATATACCCAGGAGGG + Intergenic
986012788 5:3731779-3731801 CTTTGGAGAAAGAGCTGGGTGGG + Intergenic
986507526 5:8468060-8468082 CTTTGGAGAAATGCCTAGCAGGG - Intergenic
986554130 5:8993817-8993839 CTTTGAGTACATATCTAGGAAGG + Intergenic
987092978 5:14523788-14523810 CTTTGGGTAAATACTAAGGAGGG - Intronic
987199515 5:15561563-15561585 CTTTGGATATATACCCAGCAGGG + Intronic
987222355 5:15803671-15803693 CTTTGGAGAAAAGGCTAGGTAGG - Intronic
987520775 5:18980546-18980568 CTTTGGATATATAGCCAGAATGG + Intergenic
988394887 5:30684163-30684185 CTTTGGATATATATCTAGAAAGG - Intergenic
988875466 5:35440799-35440821 AGTTGGATAAATACCTAAGAAGG - Intergenic
989006463 5:36819032-36819054 CTTTGGCTAAATAGCTACTTTGG - Intergenic
989058230 5:37384999-37385021 GGTTTGATAATTAGCTAGGACGG + Intronic
990513083 5:56506923-56506945 GTTTGGATAAAAATCTTGGAAGG - Intergenic
990638615 5:57757576-57757598 CCTTGGGTAAATACCTAGAAGGG - Intergenic
990996350 5:61735985-61736007 CTTTGCATAAATAACTTGGTTGG - Intronic
993212658 5:84974259-84974281 CTTTGGCTAGATACCCAGGAGGG + Intergenic
993390139 5:87310520-87310542 CTTTGCATAAAGAAGTAGGAAGG + Intronic
994112569 5:96023289-96023311 CTCTGGATAAATAGCTCTGTGGG + Intergenic
994360919 5:98847360-98847382 GTTTGGGTAAATACCAAGGAGGG - Intergenic
994466258 5:100136528-100136550 TTTTGGATAAATACCTACTAGGG + Intergenic
995415360 5:111905218-111905240 ATTTGGGTAAGTACCTAGGAGGG + Intronic
996499136 5:124197495-124197517 CCTTAAATAAAAAGCTAGGAGGG - Intergenic
998361734 5:141594216-141594238 CTTTGGATAAATAAATACCAAGG - Intronic
998843178 5:146277981-146278003 CTTTAGGTAAATTCCTAGGAAGG + Intronic
1000394240 5:160756374-160756396 TCTTGGATAAATACTTAGGAGGG + Intronic
1002149454 5:177215487-177215509 TTTTGGATAAATACCTAGAATGG + Intronic
1003138191 6:3449133-3449155 ATTAGGATAAATTGCTAGAAAGG - Intronic
1005366219 6:25080347-25080369 CTTTTTATAAATTGCTAGGTTGG + Intergenic
1005909065 6:30292270-30292292 CTTTGGCTAAAACTCTAGGAAGG + Intergenic
1006216444 6:32447624-32447646 CTTTGGATAAATACATAGAAGGG + Intergenic
1006916661 6:37599041-37599063 CTTTGGGTATATACCTAGTAAGG + Intergenic
1008463609 6:51805020-51805042 CTTTGGATATATACCCAGTAAGG - Intronic
1008757282 6:54811222-54811244 TTTTTGATAAATAGCTAGAATGG + Intergenic
1009021952 6:57955697-57955719 GCTTTGATAATTAGCTAGGACGG - Intergenic
1010716133 6:79232679-79232701 CCTTGAATAAACAGCAAGGAAGG + Intronic
1011229654 6:85146102-85146124 CTTTGGATATATACCCAGTATGG + Intergenic
1011414479 6:87103096-87103118 TCTTGGATAATTACCTAGGAGGG - Intergenic
1011566305 6:88676887-88676909 TCTTGGGTAAATATCTAGGAGGG - Intronic
1011987063 6:93460598-93460620 TTTTGGATAAATACTAAGGATGG + Intergenic
1012523601 6:100150584-100150606 CATTTGATAAATATTTAGGAGGG + Intergenic
1012688835 6:102288126-102288148 CTTTTGATAAATACCCAGTAGGG - Intergenic
1013279014 6:108617128-108617150 CTTTGGGTATATGCCTAGGAGGG + Intronic
1013988101 6:116220609-116220631 TTTTGCATAAATAGCCAAGAAGG - Intronic
1014441580 6:121479758-121479780 CTTTGGATAATTAGCCAAGATGG + Intergenic
1016726859 6:147381224-147381246 CTTTGGATAAATATCTATTGAGG - Intronic
1018271976 6:162089528-162089550 TTTTGGATATATACCTAGAAGGG - Intronic
1020489602 7:8763930-8763952 TTTTGGGTAAATACCTAAGAAGG + Intergenic
1020917878 7:14219584-14219606 CTTTGGATAAATGTCTATTAAGG + Intronic
1021213546 7:17886777-17886799 ATTTGGATAGATAGAGAGGAAGG - Intronic
1021367412 7:19796906-19796928 CTTTGGATAAATATACAGTATGG + Intergenic
1021535548 7:21700600-21700622 CTTTGGGTATATACCTAGAAAGG - Intronic
1021733451 7:23619486-23619508 CATTGGAAAAATAGGCAGGAAGG - Intronic
1022693293 7:32679789-32679811 CTTTGGAAAGATAGCAAGGGTGG + Intergenic
1023581956 7:41692974-41692996 CCTTGGATAACTAGCCTGGAGGG + Intronic
1024171592 7:46793234-46793256 CTTTGGATATATACCCAGAAGGG + Intergenic
1024435743 7:49352965-49352987 CTCTGGATCAGTAGATAGGATGG + Intergenic
1026542557 7:71293204-71293226 CTTTGGATATATATCTAAAATGG + Intronic
1028045496 7:86112434-86112456 CTTTGGATATATAACCAGTAGGG + Intergenic
1028064800 7:86370111-86370133 CTTTGGATAAATATTCAGTAGGG + Intergenic
1028728189 7:94113213-94113235 CTTTGTAGAAAAAGTTAGGAAGG - Intergenic
1028969572 7:96842726-96842748 CTTTGGATATATACCCAGTAAGG + Intergenic
1030456973 7:109787377-109787399 CATTGTGTAAATAGCTAGAACGG - Intergenic
1030522457 7:110615076-110615098 CTTTGGATATAAACCTAGTAGGG + Intergenic
1030735272 7:113040913-113040935 CTTAGGATAAATTCCTAGGGGGG - Intergenic
1031175695 7:118346275-118346297 CTTTGGATAGATAGATAGTCTGG + Intergenic
1031788340 7:126064305-126064327 CTTTGGATAAATTTCTATGTAGG - Intergenic
1031800175 7:126233322-126233344 CTTTGGAAAAACAGAGAGGAAGG + Intergenic
1032143729 7:129358994-129359016 CTACGGATATATATCTAGGAGGG - Intronic
1033772842 7:144572756-144572778 TTTGGGATATATACCTAGGAAGG - Intronic
1034602521 7:152274842-152274864 CTTTGGATACAAAGATAGTATGG - Intronic
1038029629 8:23626439-23626461 GTTTGTATAAATAGTTGGGATGG + Intergenic
1039173603 8:34778926-34778948 CTTTGGATATATACCCAGTATGG - Intergenic
1039353240 8:36785670-36785692 ATATGGGTAAATAGCTATGATGG + Intronic
1039400387 8:37264093-37264115 TTTTGGATAAATACCCAGTAGGG - Intergenic
1041272791 8:56125276-56125298 CTTTGGATAAATAGCGAGTGTGG + Intergenic
1042451536 8:68953036-68953058 TCTTGGGTAAATACCTAGGAGGG - Intergenic
1042852577 8:73231154-73231176 CTTATGATAAATATTTAGGATGG - Intergenic
1042876291 8:73443224-73443246 CTTTGGATAAATATGTGGAAAGG + Intronic
1044750280 8:95409126-95409148 GTTTGGAGAAAAAGTTAGGAAGG - Intergenic
1045897660 8:107238246-107238268 CTTCTGATAAATAGGTAGGTAGG + Intergenic
1046151066 8:110226760-110226782 CTTTGGATATATACCTAGAAAGG + Intergenic
1046975244 8:120267860-120267882 CTTTGGTGAAATAGGGAGGATGG + Intronic
1047708666 8:127527631-127527653 CATTGGGTAAATATCAAGGAGGG + Intergenic
1048347931 8:133591975-133591997 CTTTGGACAAATAGCCAAGGAGG + Intergenic
1050189787 9:3012798-3012820 TTTTGGGTGTATAGCTAGGAGGG + Intergenic
1053625446 9:39866303-39866325 CTTTGGATATATACCTAGATGGG + Intergenic
1053685699 9:40519377-40519399 CTTTTAATAAATAACTAGGGAGG + Intergenic
1053711175 9:40809956-40809978 CTTTTAATAAATAACTAGGGAGG + Intergenic
1053893242 9:42717439-42717461 CTTTGGATATATACCTAGATGGG + Intergenic
1053935655 9:43147689-43147711 CTTTTAATAAATAACTAGGGAGG + Intergenic
1054218442 9:62384398-62384420 CTTTGGATATATACCTAGATGGG - Intergenic
1054298783 9:63354831-63354853 CTTTTAATAAATAACTAGGGAGG + Intergenic
1054396805 9:64659348-64659370 CTTTTAATAAATAACTAGGGAGG + Intergenic
1054421085 9:64930773-64930795 CTTTTAATAAATAACTAGGGAGG + Intergenic
1054431446 9:65164552-65164574 CTTTTAATAAATAACTAGGGAGG + Intergenic
1055660865 9:78502736-78502758 CTGTGGATAAATGTCTATGAGGG + Intergenic
1055807382 9:80111747-80111769 CTTTAAATCAATAGCTAGAAAGG - Intergenic
1057238672 9:93389200-93389222 CTTAGGATAAATACCCAGAAAGG + Intergenic
1058554475 9:106152316-106152338 CTTTGGGTATATGCCTAGGAAGG - Intergenic
1058593024 9:106585299-106585321 CTTAGGATTAAGAGCTTGGAAGG - Intergenic
1059923318 9:119181508-119181530 CTTTGTCTTAAGAGCTAGGATGG + Intronic
1060676576 9:125520740-125520762 CTTTGGAGGAAGAGGTAGGATGG - Intronic
1062522703 9:136964955-136964977 TTTTGGGTAAATACCCAGGAAGG - Intergenic
1062701753 9:137909704-137909726 TTTTGGATATATAGCTAGAAGGG + Intronic
1185686393 X:1932358-1932380 CTTTGGATAAATTCCCAGCAGGG + Intergenic
1185753471 X:2633090-2633112 TTTTGGGTAAATACCCAGGAGGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188051885 X:25497771-25497793 CTTTGGAGAAAAAGCAAGCAGGG + Intergenic
1188863275 X:35284429-35284451 CTTTGGATATATGCCCAGGAAGG - Intergenic
1188919449 X:35954384-35954406 ATTTGCATAAATATCCAGGATGG - Intronic
1189325404 X:40108364-40108386 GCTTGGACAAATAGCTGGGAGGG + Intronic
1190505602 X:51123049-51123071 CTTTGGATATATATCCAGAAGGG + Intergenic
1191058425 X:56268304-56268326 CTTTGGATATATACCCAGAAGGG + Intronic
1193739245 X:85198331-85198353 TTTTGGGTATATAGCTAGCAGGG + Intergenic
1194588795 X:95771217-95771239 CTTTGGATATATACCCAGTAAGG - Intergenic
1195459984 X:105113866-105113888 CTTTGAATAAATAGCTTTCATGG - Intronic
1195585438 X:106559945-106559967 CTTGGGATAAATAGCTGTGGGGG - Intergenic
1195691700 X:107631545-107631567 CTTAGAATAAATCCCTAGGAAGG + Intronic
1199363375 X:146947882-146947904 CTTTGGTTAAATACGTAGGATGG + Intergenic
1199490477 X:148393438-148393460 CTTTGGATAGGTACCTAGTAGGG - Intergenic
1199727996 X:150603942-150603964 CTTTGGATAAAGGGCTGTGATGG + Intronic