ID: 1122851809

View in Genome Browser
Species Human (GRCh38)
Location 14:104537483-104537505
Sequence CCTGGGGCCCTGCATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122851802_1122851809 4 Left 1122851802 14:104537456-104537478 CCCACTAGACATTAAAGGAAGCT 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1122851809 14:104537483-104537505 CCTGGGGCCCTGCATGAGAAGGG 0: 1
1: 0
2: 1
3: 24
4: 254
1122851799_1122851809 14 Left 1122851799 14:104537446-104537468 CCTTAAACCTCCCACTAGACATT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1122851809 14:104537483-104537505 CCTGGGGCCCTGCATGAGAAGGG 0: 1
1: 0
2: 1
3: 24
4: 254
1122851803_1122851809 3 Left 1122851803 14:104537457-104537479 CCACTAGACATTAAAGGAAGCTT 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1122851809 14:104537483-104537505 CCTGGGGCCCTGCATGAGAAGGG 0: 1
1: 0
2: 1
3: 24
4: 254
1122851801_1122851809 7 Left 1122851801 14:104537453-104537475 CCTCCCACTAGACATTAAAGGAA 0: 1
1: 0
2: 1
3: 14
4: 141
Right 1122851809 14:104537483-104537505 CCTGGGGCCCTGCATGAGAAGGG 0: 1
1: 0
2: 1
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122851809 Original CRISPR CCTGGGGCCCTGCATGAGAA GGG Intronic
900203680 1:1422049-1422071 CCTGGGGCCAGGCAGGAGAAGGG + Intergenic
901166360 1:7224614-7224636 CCTGGGACCCCGCTTGAGCAGGG - Intronic
901686938 1:10948292-10948314 CCTGGGGCTCTCCGGGAGAACGG + Exonic
902290123 1:15429792-15429814 CCTGGTGCCCTGCACCAGACAGG + Exonic
902378201 1:16040095-16040117 CCTGGGGCCCTGGGTGAGGGTGG + Intergenic
903269493 1:22178561-22178583 CCTGGGGACCTGCATGACATAGG - Intergenic
903858597 1:26351947-26351969 TCTGGGGCCCTGCAGAAGAAAGG - Intronic
904914882 1:33962598-33962620 CCTGGGGCCCTGCAGGCCATTGG - Intronic
905168661 1:36098062-36098084 CCTGGGGCCTTCGATGAGACTGG - Exonic
906492358 1:46278535-46278557 CCTGGGTGCCTGCTTGAGGAGGG + Exonic
906948641 1:50316735-50316757 CATGGGGTGCTGCAGGAGAAGGG + Intergenic
907560319 1:55381821-55381843 CCTGGCCCCCAGCATGAGCATGG - Intergenic
908260791 1:62338136-62338158 CCTGTGGCCCAGCACGAAAAGGG - Intergenic
915163860 1:153937537-153937559 CCTGGGGCCCTGCCTGTGCCAGG - Exonic
915314444 1:155020080-155020102 CCAGGTGGCCTGCCTGAGAAAGG - Intronic
915962435 1:160278512-160278534 CATGGGGCCTTGCAGGAAAAGGG + Exonic
917031171 1:170693472-170693494 CCTGGTACCCTTCATAAGAAAGG - Intronic
919810477 1:201405944-201405966 CATGGGGCCCTGGCTGAGAGTGG - Exonic
920107660 1:203565784-203565806 CCTGGGGCACAGGAAGAGAAGGG - Intergenic
920746235 1:208631665-208631687 CCTGGGGAGCTGGATGGGAAGGG - Intergenic
921356060 1:214285361-214285383 CCTGAAGCTGTGCATGAGAAGGG + Intronic
921500739 1:215899777-215899799 CTTAGCGCCCTGCAAGAGAAAGG - Intronic
923024537 1:230194384-230194406 TCTGGACCCCTGCAGGAGAAGGG - Intronic
1064465848 10:15581074-15581096 CCTGGGGCCTTGAATCACAATGG + Intronic
1065725830 10:28667273-28667295 CCTGGGGCCCAGCATTAGCTTGG - Intergenic
1066616510 10:37300376-37300398 CCTGGGGCCCTGACTGAGGCAGG + Intronic
1067083983 10:43228534-43228556 CCTGGGTCCCTGAATGAGGGTGG + Intronic
1067703408 10:48589568-48589590 CATGGAGCCCTGGATGAGAATGG - Intronic
1069606866 10:69744236-69744258 TCAGGGGCCCTGCCTGAGATTGG + Intergenic
1070148912 10:73793603-73793625 GCTGAGGCCCTGCATGCGCATGG + Exonic
1070563699 10:77587790-77587812 CCTGGGGCCCTGCATCTGATAGG - Intronic
1070746781 10:78938413-78938435 ACTGAGGCCCTGCATGTGAGCGG - Intergenic
1071519286 10:86319107-86319129 CCTGGGGTGCTGCAGGAGCAAGG + Intronic
1072426636 10:95335954-95335976 CCTGGGGCCCTGACTGACATGGG - Intronic
1072677430 10:97478592-97478614 ACTGTGGACCTGTATGAGAATGG - Intronic
1073112334 10:101070100-101070122 ACTGGGGCCCAGCATGGGGAAGG - Intergenic
1073447674 10:103591090-103591112 TCTGGGCCCCTGGCTGAGAAGGG + Exonic
1074693051 10:116024306-116024328 CCTGGAGCTCTTTATGAGAAAGG + Intergenic
1075173818 10:120141011-120141033 CCTGGGGTCCAGAAAGAGAAGGG - Intergenic
1075275574 10:121089750-121089772 CCTGTGGCCTGGCATGAGAGAGG - Intergenic
1075549480 10:123381640-123381662 CCTGTGGCCCTGACTGAGACGGG - Intergenic
1076020411 10:127067828-127067850 CCTGGGGCTCTACACGACAATGG - Intronic
1076658087 10:132037458-132037480 CCTGGCTCCCTCCATGACAACGG - Intergenic
1076851999 10:133097862-133097884 CCTGTGTCCCTGCATGTGGAGGG + Intronic
1077002843 11:333287-333309 CCTGGGCCTCTGCATGAGGGTGG + Intergenic
1077014086 11:392378-392400 CCTGGGGCCCTGCAGGGGCCAGG - Intergenic
1077028944 11:454919-454941 CCTGGGATTCTGCATGTGAATGG + Intronic
1077378524 11:2216646-2216668 CCTGGTGCCCTCCAGGAGAAAGG - Intergenic
1081198083 11:40185772-40185794 CCTGAGGTCTTGCATGAGGATGG + Intronic
1083203874 11:61135800-61135822 CATGGGGCCCTGCAAGGGATGGG - Intronic
1083257113 11:61503302-61503324 CCTGGGGCCTGGGATGGGAAAGG + Intergenic
1087691290 11:101323462-101323484 CATGGGGCCTTGTATCAGAAGGG + Intergenic
1088627316 11:111738602-111738624 CCTGGGGCTCTGCATCACAGTGG + Intronic
1089157666 11:116414703-116414725 CCTGGAGCCCCGCCTGGGAATGG - Intergenic
1089299463 11:117489933-117489955 CCTGGGGCACTGGAGGAGGACGG - Intronic
1089643239 11:119861288-119861310 CCTGGGGCCCAGGATGGGGAGGG - Intergenic
1089706369 11:120280914-120280936 CCTGGGCCTGTGCGTGAGAAGGG + Intronic
1089768552 11:120786073-120786095 CTAGGAGCCCTACATGAGAACGG - Intronic
1091366961 11:135030484-135030506 CCTGAGGCTTTGCATCAGAAAGG + Intergenic
1091903445 12:4164377-4164399 CCTGGGGACCAACCTGAGAATGG - Intergenic
1092217648 12:6694265-6694287 CCTGCTGCACTACATGAGAAAGG - Exonic
1093013233 12:14130029-14130051 CCTGGGCCACTGCATGAGGAAGG + Intergenic
1094716377 12:33018721-33018743 CCTGTGGCCCTAAATGATAATGG + Intergenic
1096072246 12:48781891-48781913 CCTGGTGCCCAGCATGGGGAAGG + Intronic
1096262172 12:50099745-50099767 CCTGGGGCTCTGAAAGGGAAAGG - Exonic
1096464583 12:51841194-51841216 CCTGTGGCCCTGCAGGTGTAGGG - Intergenic
1096529675 12:52234723-52234745 CCTGAGGCCTTGCTGGAGAAAGG + Intronic
1096648202 12:53049408-53049430 CCTGGGGGCTTTCAGGAGAAGGG + Intronic
1100303854 12:93332675-93332697 CCTGGGGACCTTCCTAAGAAAGG - Intergenic
1101212094 12:102544714-102544736 CCTGTGGCCCAAAATGAGAAGGG + Intergenic
1103166310 12:118773378-118773400 CCTGAGGCCCTAAATGAGAATGG - Intergenic
1104083940 12:125457677-125457699 CCTGGGGCTCTGCAAGGGAAGGG + Intronic
1107942008 13:45383458-45383480 TCTGGGGCCCTGGATGAGGCCGG - Intergenic
1107958875 13:45542024-45542046 CATGGGGCCCTGCAAGAGCTGGG + Intronic
1113730332 13:112637037-112637059 TCTGGGGCTGTGCATGACAAGGG + Intergenic
1116118229 14:40685268-40685290 CCTGGGGCCTTGAATAAGACAGG - Intergenic
1116916641 14:50532253-50532275 CCAGGGGCCGTGGAAGAGAAAGG + Intronic
1118636656 14:67754237-67754259 CCTGGGGCCCCTCATGAGGCTGG - Intronic
1118916557 14:70112339-70112361 TCTGGGGCCATGCATGAGAAAGG + Intronic
1119417803 14:74486144-74486166 CCATGGACCCTGCATGAGAAGGG + Intronic
1121777466 14:96599912-96599934 CCTGGGGCCATGCTTGAGCTGGG + Intergenic
1122267375 14:100553012-100553034 CCTGGAGCCCTACAGGAGACTGG + Intronic
1122851809 14:104537483-104537505 CCTGGGGCCCTGCATGAGAAGGG + Intronic
1124833539 15:33173539-33173561 TCTGGTGCCCTGCATTAAAATGG - Intronic
1126495138 15:49281839-49281861 CCTGGAGCACTGCATTAAAAAGG - Intronic
1129172559 15:73817090-73817112 CCTGGTGCCCTGGATGGGATGGG + Intergenic
1129670590 15:77605753-77605775 CCAGCTGCCCTGCAGGAGAAAGG + Intergenic
1130069110 15:80631481-80631503 GCTGGGGCCCCTCATCAGAAGGG + Intergenic
1130330326 15:82917441-82917463 CCTGGGGCCCTGGGAGAGGAGGG - Intronic
1130660917 15:85830926-85830948 CCAGCAGCCCTGCATGATAAGGG - Intergenic
1130865398 15:87929426-87929448 CCATGGGCCCTGCAAGAGCATGG + Exonic
1131952115 15:97692351-97692373 ATTGGGGGCCTGCTTGAGAAAGG - Intergenic
1132250588 15:100332928-100332950 CCTGGGAACCTGCGTGAGGAAGG + Intronic
1132546415 16:535373-535395 CCAGGGGACGTGCACGAGAAGGG - Intronic
1132761477 16:1510540-1510562 CCGTGGGCCCTGCAGGAGTATGG + Exonic
1132796222 16:1724479-1724501 CCTGCGGCCCTTCAAGTGAAAGG + Intronic
1133918483 16:10130794-10130816 CCTGGGGACCTGCTTGAGTCAGG - Intronic
1136275693 16:29178062-29178084 CCTGGGGCCATGCCAGAGCAAGG + Intergenic
1136570421 16:31093474-31093496 CCTTGGACCCTGCCCGAGAAAGG + Intronic
1136575327 16:31120523-31120545 CCTGGGCCCGTGGATGGGAAGGG - Intronic
1138366576 16:56483503-56483525 CCTGGGTCCCTGCATAACTATGG + Intronic
1139911390 16:70399495-70399517 CCTGGCGCCCGACATGTGAAGGG - Exonic
1142093756 16:88228379-88228401 CCTGGGGCCTTGCCTTACAATGG + Intergenic
1142096481 16:88242667-88242689 CCTAGGACCCTGCCTGGGAAAGG - Intergenic
1142264125 16:89055715-89055737 CCAGGTGCCCTGCATGAGCCCGG - Intergenic
1143870593 17:9955150-9955172 CCTAGGTCCCTGGATCAGAAGGG + Intronic
1144586041 17:16488384-16488406 TCTTGGGCCATGCCTGAGAAAGG + Intronic
1145838948 17:27977733-27977755 CCTGGGTCTCTTCTTGAGAATGG - Intergenic
1146721806 17:35129303-35129325 CCTGGGCCCCAGCAGGAGCAGGG + Intronic
1147038490 17:37699501-37699523 CCTGCCTCCCTGCATGAGAAGGG - Intronic
1148887312 17:50783267-50783289 CCAGTGGCCTTGCATGGGAATGG - Intergenic
1150267248 17:63839463-63839485 CCTGGGGCCCTGAGTGAGCCAGG - Intronic
1151471133 17:74318489-74318511 CCAGGAGGCCTCCATGAGAAAGG + Intergenic
1151579863 17:74971919-74971941 CCCGAGGCCCTGCAAGGGAAAGG - Intronic
1151744576 17:76005044-76005066 CCTGGGACCCTCCCCGAGAAGGG + Intronic
1152700940 17:81819525-81819547 CCTGGTGCCCTGCATGGACAAGG + Intergenic
1152756653 17:82089842-82089864 CCTTGGAGCCTTCATGAGAAAGG + Intronic
1152832082 17:82503623-82503645 CCCAGTGCCCAGCATGAGAATGG + Intergenic
1152882548 17:82827418-82827440 CCTAAGGCTCTGCTTGAGAAAGG - Intronic
1153757644 18:8300183-8300205 ACTGGGGACTTGCAGGAGAAGGG + Intronic
1153780645 18:8492564-8492586 CCTGTGGCCCTGCGTGGGTATGG - Intergenic
1154356283 18:13624997-13625019 CCTCGGGTGCTGCAGGAGAAAGG - Intronic
1155905137 18:31441692-31441714 CCTGGAGCCCTGCCTGCTAATGG - Intergenic
1156476670 18:37409908-37409930 CCTGAGGCGCTGCATGTGAAGGG - Intronic
1156536207 18:37867034-37867056 CCTGGGGCCACGGATGATAATGG + Intergenic
1157812386 18:50706683-50706705 CCTGGGGTGCTGCATGACAATGG - Intronic
1159013289 18:63079999-63080021 CCACAGGCCCTGCATGAGACAGG + Intergenic
1160697908 19:493530-493552 GCTGGGACCCTCCATGGGAAGGG + Intronic
1160697922 19:493563-493585 GCTGGGACCCTCCATGGGAAGGG + Intronic
1160740507 19:683349-683371 CCTGGGGCCCTGCCTCACCAAGG + Exonic
1160768101 19:817562-817584 ACTGGGGCCATGCCTGAGCAAGG - Intronic
1160846483 19:1168361-1168383 GCTGGGGCCCTGGTGGAGAATGG - Intronic
1162052951 19:8046194-8046216 CCTGGGGCCCCGCATGTGGCTGG + Intronic
1166570210 19:43790943-43790965 CCTGTGGCCATGCAGGAGACAGG - Intergenic
1167143817 19:47670614-47670636 CCTTGGCCCCTGGATGAGGAAGG + Intronic
1167330435 19:48852430-48852452 CCTGGAGCCCTGCAGGCGTATGG + Intronic
1167428224 19:49440576-49440598 CCTGGGTCCCTGGGAGAGAAAGG - Intronic
1167645051 19:50701121-50701143 CCTGGGCCCCTGAATAAGCAGGG - Intronic
1167765283 19:51478614-51478636 CCTGGGGTCCTCCAGGAGGAGGG - Exonic
1168465536 19:56598302-56598324 CCTGGGGCCAAGCATGGGAGAGG + Intronic
925979299 2:9164191-9164213 CCTGGGGCCCAGCCTGAGGAGGG + Intergenic
926420837 2:12696533-12696555 CCTTTGTCCCTGCAAGAGAAAGG + Intergenic
926786988 2:16527788-16527810 CCTGGTGCCCTTCATGATAGAGG - Intergenic
927673550 2:25088951-25088973 CCTGGGGCCCTGCCTGGGACTGG + Intronic
931267649 2:60674702-60674724 CATGGGGACCTGCGTGAGCACGG - Intergenic
931853378 2:66276181-66276203 CCTGGGGCCCTGCAGGATGTTGG + Intergenic
932479324 2:72029125-72029147 CCTGGGGCCCTGACTCAGAGGGG + Intergenic
932579227 2:72982814-72982836 CCTGGGGCCCGGCAAGAGGGAGG + Intronic
933609082 2:84415513-84415535 CCTGGAGCCCAGGATGTGAAGGG - Intergenic
934559355 2:95304610-95304632 CCTGGCAAGCTGCATGAGAACGG + Intronic
936578067 2:113671844-113671866 CCTGGGGCCCTCCGTGAGCCTGG + Intergenic
937283603 2:120736469-120736491 CCTGGGGCTCTGGACGAGCAGGG + Intronic
937344911 2:121119495-121119517 CCTGGGGACCTGAAAAAGAAAGG + Intergenic
937345125 2:121120727-121120749 CTTGGGGGGCTGCAAGAGAAGGG + Intergenic
937363080 2:121242542-121242564 CCTGGGGCCCTGGGTGAGGTGGG - Intronic
938089794 2:128424015-128424037 CCTGGGGCTCAGCATGTAAATGG + Intergenic
944586632 2:201178851-201178873 CCTGGGGCCTTGAATGGCAATGG + Intergenic
947455530 2:230250535-230250557 CCTGATGCCCAGTATGAGAAAGG + Intronic
947736370 2:232457490-232457512 CCAGGGGCTATGCATGAGGAGGG + Intronic
947752433 2:232539978-232540000 CCTGGGCCCCTGCAATAGACAGG - Exonic
947879751 2:233497455-233497477 CCTGGAGCCAAGCATGGGAATGG + Intronic
948082108 2:235214832-235214854 CCTGGTGCCCTGCTTCTGAAAGG - Intergenic
948772596 2:240259157-240259179 CCTGAGGCCCTGAGGGAGAATGG + Intergenic
948846059 2:240683305-240683327 CCTGGGGCCCTCACTGAGATGGG - Intergenic
948847797 2:240691424-240691446 CCTGGGGCCCTCACTGAGATGGG + Intergenic
948856751 2:240733845-240733867 CCTGGGTCCCTGCATGACTGTGG - Intronic
1168921184 20:1537549-1537571 CCTGGGCTCCTGGATGAGGAAGG - Intronic
1169969155 20:11249929-11249951 CCTGGACCTTTGCATGAGAAAGG - Intergenic
1170666774 20:18393350-18393372 CCTGGTGCCCAGCATGAGGATGG - Intronic
1170905723 20:20514035-20514057 CCTGGAGTCCTGCCTGGGAATGG - Intronic
1172592745 20:36128939-36128961 CCTGGGGTCCTGGATGAGGTGGG + Intronic
1174069291 20:47888564-47888586 TCTAGGGCCCTGCATGGGGATGG - Intergenic
1175999667 20:62826190-62826212 CCGGGGGCCCTGCGAGAGAGAGG - Exonic
1176111220 20:63411597-63411619 CCTGGGGCCCTGGTGGAGGAAGG + Intronic
1176220958 20:63969305-63969327 ACTGGCGCCCCGGATGAGAAGGG + Intronic
1177961246 21:27669575-27669597 CCAGGGTCCCTGAAAGAGAAAGG - Intergenic
1178249246 21:30986234-30986256 CCTGGGTATCTGCATGAGCATGG + Intergenic
1179627727 21:42658095-42658117 CCTGGGCTCCCGCATGTGAAGGG - Intronic
1180140649 21:45891833-45891855 CCCGGGGCTGTGCAGGAGAAGGG - Intronic
1180921257 22:19522768-19522790 CCTGGGGCCCGGGATGGGACAGG - Intergenic
1180982720 22:19886431-19886453 CCTGGAGCCCTGCAGGAGGTTGG + Intronic
1183530584 22:38351318-38351340 CCTGGGGCCCAGCCTCAGGAAGG - Intronic
1183652840 22:39168825-39168847 ACTATGGCCCTGCAGGAGAATGG + Intergenic
1184797724 22:46741503-46741525 CCAGGGGCCCAGGAAGAGAAGGG - Intergenic
1185422154 22:50740812-50740834 CCTGGGGCCCTCCGTGAGCCTGG - Intronic
949340693 3:3027366-3027388 CTTGGGACCCTGACTGAGAAAGG + Intronic
950503137 3:13377020-13377042 CCTGGAACCCTGCATGACAGAGG - Intronic
952163559 3:30720938-30720960 TCTGGACCCCAGCATGAGAAAGG + Intergenic
952884292 3:38003127-38003149 GCTCAGGCCCTGCATGAGGAGGG - Intronic
953064809 3:39459173-39459195 CCTGGGACTGTGCCTGAGAAGGG - Intergenic
953214096 3:40901756-40901778 CTTGAGGCCCTGTATGAGAAGGG + Intergenic
954656060 3:52195020-52195042 CCTGGGGCCCAGAATAAAAAGGG + Intergenic
956062784 3:65364860-65364882 CCTGGGTCCCTTGCTGAGAAGGG + Exonic
959595043 3:108120601-108120623 ACAGGGGCCGTGCATGGGAAAGG - Intergenic
961347543 3:126273971-126273993 CTTGGGGTCCTGCAGGACAATGG + Intergenic
962266798 3:133949572-133949594 CCAGGGGCCTTGCATCTGAAAGG - Intronic
962609474 3:137062253-137062275 ACTGGGGCCCTGCTTGGGAGTGG - Intergenic
966489844 3:180516174-180516196 CCAGGGGCCCTTGATGAGAGCGG - Intergenic
966494613 3:180565866-180565888 TCTGGGACCCTGCTTCAGAATGG + Intergenic
968491521 4:892939-892961 CCTGGGCTCCTGCAGGAGCAGGG - Intronic
968506289 4:972827-972849 TCTGGGCCACAGCATGAGAAGGG + Intronic
968868897 4:3231225-3231247 TCTGGGGCCCTTGGTGAGAATGG + Intronic
968986167 4:3875681-3875703 CCTGGGGACCAGCATGGGCAGGG - Intergenic
969049548 4:4362999-4363021 ACAGGGTCCCTGCAAGAGAAAGG + Intronic
969243761 4:5919173-5919195 CCAGGGGCCCTGAATGAGAGAGG - Intronic
969683070 4:8653809-8653831 CCTGAGGCCCTGTGGGAGAATGG + Intergenic
969839728 4:9872051-9872073 CCCGGGTCCCTGGATGAGGAGGG - Intronic
970385925 4:15556590-15556612 GCTGGGGCCTTGCATGGGAAAGG - Intronic
971625427 4:28914464-28914486 CCGGGAGCTCTGGATGAGAAGGG + Intergenic
975961547 4:79913796-79913818 GCTGGGGTAGTGCATGAGAAGGG + Intronic
976937043 4:90649449-90649471 CGTGGGGCCCTGAATCAGTAGGG + Intronic
977552400 4:98456386-98456408 TCAGGGGCCCTGCAAGGGAAAGG - Intergenic
977761746 4:100746121-100746143 CCTGGCGATCTGCATGAGTATGG - Intronic
978514152 4:109553449-109553471 CATCGGCCCCTGCATCAGAATGG + Intergenic
980973557 4:139589081-139589103 CCTGTGGGACTGCCTGAGAAAGG - Intronic
981632563 4:146837329-146837351 ACTGGGGACCTGCTTGAGAATGG + Intronic
983079514 4:163367911-163367933 CCTGGGGCTCTGCTGGAGCAAGG - Intergenic
984613791 4:181872731-181872753 CCTTGGTACCAGCATGAGAACGG + Intergenic
985650337 5:1104624-1104646 CCTGGGGTCCGGGATGAGAGTGG - Intronic
985697473 5:1348921-1348943 CCTAGGGCCCTGGGTGAGACTGG + Intergenic
987531861 5:19131009-19131031 CCTCTGGGCCTGTATGAGAAGGG + Intergenic
988689831 5:33561140-33561162 CCTGGGGGCCTACTGGAGAAGGG - Exonic
994755236 5:103787130-103787152 CTAAGGGCACTGCATGAGAAAGG - Intergenic
996895039 5:128470715-128470737 CATGAGGCCCTACTTGAGAAGGG + Intronic
997279484 5:132630431-132630453 CCTGGGTCCCTGCATTCGAGGGG + Intronic
997280359 5:132639743-132639765 CCAGGGGCTCTGCATGTGAGTGG + Intronic
997810743 5:136965580-136965602 CCTGGGGCTCAGCATGGGAAAGG + Intergenic
1001326758 5:170733954-170733976 CCTGGGGACCTGCAGAAGGAAGG + Intronic
1003268995 6:4590920-4590942 CCTGTGAGTCTGCATGAGAAAGG - Intergenic
1003307244 6:4940771-4940793 CCTGGGGCACTGCTTGGGCAGGG - Intronic
1004880596 6:20003509-20003531 CATTGAGCCCTGCATGAAAAGGG + Intergenic
1005136059 6:22570463-22570485 CCTGGGGCCCGGCAGGGCAAAGG - Exonic
1006430952 6:33995359-33995381 CCTGGTGGCCTGCTTGGGAAAGG - Intergenic
1006732090 6:36243788-36243810 CCTGGGGAATTGCATGGGAAAGG + Intronic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1007712991 6:43836393-43836415 CCTGGGGAACTGCAGGAGCAAGG + Intergenic
1012228792 6:96736420-96736442 ACTCAGGCCCTGCATTAGAAGGG - Intergenic
1012945413 6:105460893-105460915 CCTGTGGCCCTAAATGGGAATGG + Intergenic
1018372854 6:163184702-163184724 CCTGCCGCACTGCACGAGAAAGG + Intronic
1021579689 7:22139669-22139691 CCAGGGGCCCTGCAAGTGAGAGG + Intronic
1023888112 7:44375139-44375161 CCTGGAGACATGGATGAGAAAGG - Intergenic
1029156390 7:98520778-98520800 GGCGGGGCCCTGGATGAGAATGG + Intergenic
1029356807 7:100058059-100058081 CCTGGGCCCTAGCATGGGAATGG + Intronic
1033206457 7:139427222-139427244 ACTGGGGCCATGCATGAGTGGGG + Intergenic
1034546886 7:151795039-151795061 CCTGGGGCCCTGAACTAGGAAGG - Intronic
1035102936 7:156416271-156416293 CCTGAGGCCCTGGAGGAGAGAGG + Intergenic
1036382308 8:8244575-8244597 CCTGGGGCTGGGCCTGAGAAGGG - Intergenic
1037885739 8:22595278-22595300 CCTGGGTGGCTGCCTGAGAAAGG + Intronic
1038324996 8:26566341-26566363 AAAGGGGCCCTGCAGGAGAAAGG + Intronic
1038466216 8:27766292-27766314 CCTGGAGCCCTGAAGGACAAAGG + Intronic
1039811774 8:41055311-41055333 ACTGGGGCCCTGAAAGAGCAGGG + Intergenic
1043035567 8:75193565-75193587 CCTGAGGCCACGCATGTGAAAGG + Intergenic
1043543956 8:81294613-81294635 GCTGGGGACCTGCAGAAGAAGGG - Intergenic
1045357450 8:101402385-101402407 CCTTTGGCCCTGGATGAGGATGG - Intergenic
1047354589 8:124108478-124108500 CCTGGGGCCCAGAAGGAGATGGG - Intronic
1048312822 8:133339002-133339024 CCTGGGGCCTTGGAGGAGAAGGG - Intergenic
1048312831 8:133339034-133339056 CCTGGAGCCTTGGAGGAGAAGGG - Intergenic
1049247134 8:141568913-141568935 GCTGGGCCCCTCCTTGAGAAAGG + Intergenic
1056332787 9:85535642-85535664 GCTCTGGCCCTGCAAGAGAATGG + Intergenic
1056815698 9:89799307-89799329 CATAGGGCCAAGCATGAGAAAGG - Intergenic
1056830323 9:89911880-89911902 CCCGGGGCCCTCCATGGAAAGGG + Intergenic
1057386920 9:94612903-94612925 CCTGGGCATCTGCAGGAGAATGG - Intronic
1060976096 9:127766123-127766145 CCAGGGGCCCTGTAGGAGAAGGG + Intronic
1061149609 9:128821307-128821329 ACTGGGGACCTGCATGGGGAAGG - Exonic
1061149618 9:128821346-128821368 ACTGGGGACCTGCATGGGGAAGG - Exonic
1061149629 9:128821385-128821407 ACTGGGGACCTGCATGGGGAAGG - Exonic
1061430482 9:130527480-130527502 CCTGGGGCCGTGCGTGTGCACGG - Intergenic
1061680291 9:132239693-132239715 ACTGGGCCCCTGCAGGAGGAGGG - Intronic
1062309544 9:135928645-135928667 CCTGGGCTCCTGAATGACAAGGG - Intergenic
1062325920 9:136012451-136012473 CCTGGGCTCCTGCCAGAGAAAGG - Intronic
1185886548 X:3788710-3788732 CCTGGGGACCTGCAAGGGCAAGG - Intergenic
1187932996 X:24311245-24311267 CCTGTGGCCCTGGCTGAGGAGGG + Intergenic
1189607405 X:42694631-42694653 CCTGAGGCCCTGAGTGAGGATGG + Intergenic
1192423303 X:71053133-71053155 CCTGGGGCTCTTCCTGAGATGGG - Intergenic
1194822199 X:98523383-98523405 CCTGAGGCCATGCAAGATAAGGG + Intergenic
1197481626 X:126994175-126994197 GCTGGGGCCCTGCCAGAGAATGG - Intergenic
1197501560 X:127248612-127248634 CCTGTGCCACTGCATTAGAAAGG + Intergenic
1198532271 X:137558651-137558673 CCTGGGCCTCTTGATGAGAAAGG + Intergenic
1200165515 X:154032638-154032660 CCTGGGGCCTTGCATGTGGTGGG - Intronic
1200775725 Y:7168400-7168422 CCTGGGGATCTGCAAGGGAAAGG + Intergenic