ID: 1122853266

View in Genome Browser
Species Human (GRCh38)
Location 14:104548030-104548052
Sequence CTGTACACACATCTGCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122853266 Original CRISPR CTGTACACACATCTGCATCC AGG Intronic
900337753 1:2173094-2173116 CTCCACCCACTTCTGCATCCTGG + Intronic
900531450 1:3155439-3155461 CTGTACACAGATTTGCACCGTGG + Intronic
902543218 1:17168980-17169002 CTGTTCTCACTTCTGCCTCCTGG + Intergenic
902785354 1:18729617-18729639 CAGGACACACAACTGAATCCAGG - Intronic
905233643 1:36530597-36530619 CTGCCCACACCTCTGCAACCAGG + Intergenic
905242449 1:36589651-36589673 CTGTCCACACAGCTTCAGCCAGG - Intergenic
905294988 1:36948662-36948684 CTGTGCACACAGCTCCATGCCGG + Intronic
907974187 1:59414879-59414901 CTCCACACCCATCAGCATCCTGG + Intronic
909071536 1:70999852-70999874 CTGTACAACCATCTGCTGCCAGG + Intronic
911390119 1:97231078-97231100 CTGAGCACACATCTACACCCAGG + Intronic
912687737 1:111780144-111780166 CTGTACTCACATCTTCACTCTGG - Intronic
918289402 1:183092278-183092300 CTGTAAACTCTTCTTCATCCTGG - Intronic
922215322 1:223515613-223515635 CTGTACACTCAGCTTCTTCCAGG + Intergenic
922966204 1:229693039-229693061 CTGTCCACTCATCTGATTCCAGG - Intergenic
923696330 1:236255796-236255818 CTGTATACCCACCTGCTTCCTGG + Intronic
923727869 1:236523378-236523400 CAGTACACACCTCTGTATGCAGG - Exonic
1063192824 10:3713799-3713821 CTGAAGACACATCTACTTCCTGG - Intergenic
1063570758 10:7212738-7212760 CTGTAGGCACATATGCTTCCTGG - Intronic
1066177051 10:32918497-32918519 GTGTACACACATGTGCAAGCAGG + Intronic
1069906415 10:71735111-71735133 CTGCAGTCACATCTGCTTCCAGG - Intronic
1070166855 10:73905470-73905492 CTGCACACACACCTGCCTCCAGG + Intergenic
1070637403 10:78140287-78140309 CTGCTCACACATGTTCATCCTGG - Intergenic
1072247017 10:93552777-93552799 CTTTAGGCACATCTGGATCCAGG - Intergenic
1073050295 10:100662768-100662790 CTGTACACACATGTGTATACAGG + Intergenic
1076868732 10:133182357-133182379 GTGGACACGCACCTGCATCCTGG - Intronic
1076995826 11:297119-297141 CTCCACACACCTCTGCCTCCAGG + Intergenic
1077197503 11:1288725-1288747 CTGGACCCACATCACCATCCCGG - Exonic
1077336083 11:2005223-2005245 CTGTGCCCACATCTGCCTCCAGG - Intergenic
1077875189 11:6298805-6298827 CTGTTCACAGAGCTGCAGCCTGG - Intergenic
1078167979 11:8906951-8906973 CAGTACCCACTTTTGCATCCTGG + Intronic
1078659214 11:13272884-13272906 ATGCACACACATCTGTATGCAGG + Intergenic
1080328560 11:31108583-31108605 TTGTACACACATTTCCTTCCTGG - Intronic
1080543408 11:33292411-33292433 CTGCACACACCTCTCCACCCTGG - Intronic
1081823889 11:46027503-46027525 CTGTGCAGGCATCTGCATTCAGG - Intronic
1083852509 11:65376572-65376594 CAGTCCATCCATCTGCATCCGGG + Exonic
1083935837 11:65869728-65869750 CTGTGCACCCAGCTGCCTCCTGG - Intronic
1084352865 11:68615820-68615842 GAGTACACACCTCTGCATGCTGG + Intergenic
1086591683 11:88522405-88522427 CTGCACACACATATTTATCCAGG - Intronic
1086890836 11:92256234-92256256 CTGGACACCCATTTGCCTCCTGG - Intergenic
1086913525 11:92500642-92500664 CAGAACACACATCAGCATTCAGG + Intronic
1087637558 11:100719567-100719589 ATGCAAACACATTTGCATCCAGG + Intronic
1088037009 11:105329354-105329376 CTGGACAAAAATCTGCTTCCTGG + Intergenic
1202819067 11_KI270721v1_random:60405-60427 CTGTGCCCACATCTGCCTCCAGG - Intergenic
1094095958 12:26705199-26705221 CTGCACCCACTTCTGCTTCCTGG + Intronic
1098383011 12:69889144-69889166 CTGTACAGATCTATGCATCCTGG - Intronic
1099980501 12:89596032-89596054 ATGCACACACCTCTGCACCCAGG - Intronic
1100516835 12:95336217-95336239 TTTTATACACATGTGCATCCAGG - Intergenic
1101317329 12:103641540-103641562 CCCAACACACATATGCATCCAGG + Intronic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101539065 12:105648032-105648054 GTGTATACACATGTGCATGCTGG - Intergenic
1101751215 12:107583891-107583913 CTGTACACAAATCATCATTCAGG - Intronic
1101820803 12:108183000-108183022 CTGTGGACCCATCTGAATCCAGG - Intronic
1102434118 12:112907320-112907342 CTGTACTCACATTTGCACCCTGG - Intronic
1102954719 12:117052102-117052124 CTGTCCACTGATCTTCATCCTGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1110134004 13:72042970-72042992 CTGAACACTCATTTGCATCCTGG - Intergenic
1113963935 13:114141205-114141227 CTGCACAGAGATCTGCATACAGG + Intergenic
1114369600 14:22071235-22071257 CTGTACACAAACCCTCATCCGGG + Intergenic
1118101691 14:62613006-62613028 CTGTACAGACTTCTGCTTCTGGG + Intergenic
1121241354 14:92432182-92432204 CTGCACACCCATGTGTATCCTGG - Intronic
1121849130 14:97203289-97203311 ATGTACACACATGTGCATCCAGG - Intergenic
1121907250 14:97757714-97757736 CTGTAACCACAGCTGCTTCCCGG + Intronic
1122853266 14:104548030-104548052 CTGTACACACATCTGCATCCAGG + Intronic
1202851638 14_GL000225v1_random:23770-23792 CTGTAGCCAGATCTGAATCCTGG - Intergenic
1123631815 15:22266366-22266388 CTGCACACACAGGTGCCTCCTGG + Intergenic
1123899679 15:24863793-24863815 CTGTGGACACATCTGCGTTCTGG + Intronic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1128095542 15:64951161-64951183 GTGTACAAACATTTGCCTCCTGG - Intronic
1129031738 15:72623655-72623677 CTGGAAACACATCTGAATTCTGG + Intergenic
1129218199 15:74113809-74113831 CTGGAAACACATCTGAATTCTGG - Intronic
1130159071 15:81380930-81380952 CTGTACACACATCTGGCCCAGGG - Intergenic
1130459902 15:84153028-84153050 CTACACACACATCTCCTTCCTGG - Intergenic
1131063167 15:89416872-89416894 TTGTACGCACACCTGCAGCCCGG - Intergenic
1136271718 16:29152548-29152570 CTGCACACACAGCTGCATCTGGG - Intergenic
1137269482 16:46893992-46894014 CTGAGCACACTCCTGCATCCGGG - Intronic
1137480925 16:48851472-48851494 CTGGCCACACTACTGCATCCTGG - Intergenic
1137597209 16:49732567-49732589 ATGTACACACATGTACATACAGG - Intronic
1137729871 16:50681408-50681430 CTGTACCCACCTCTTCTTCCGGG + Intergenic
1141962414 16:87417956-87417978 CTGTGCACACGTGTGCATACAGG + Intronic
1141971179 16:87484042-87484064 CTGCACACACAGGTGCCTCCTGG - Intronic
1142016805 16:87753211-87753233 CTGTACACTAAACTGCACCCTGG + Intronic
1142075384 16:88114708-88114730 CCGCACACACAGCTGCATCTGGG - Intronic
1144386791 17:14755598-14755620 CTGTTCACACCACTTCATCCAGG + Intergenic
1146035332 17:29401327-29401349 CTATACAGGCATCTGCATCTGGG + Intronic
1147368228 17:39973607-39973629 CTACACACACATCTGCAACTCGG + Intronic
1147441025 17:40447320-40447342 AAGTCCACACCTCTGCATCCTGG + Intronic
1148006208 17:44432198-44432220 TTGTACATACATCTGAATTCTGG - Intronic
1148289315 17:46429536-46429558 CTGTCCACAAAACTGCATACAGG - Intergenic
1148311484 17:46647108-46647130 CTGTCCACAAAACTGCATACAGG - Intronic
1152500389 17:80704532-80704554 GTGTACAAACAGCTGCATCCAGG - Intronic
1154304552 18:13220665-13220687 CTGTAAACACCTCTGCAGACGGG - Intronic
1154382489 18:13865326-13865348 CTGTTCACACGCCTGCCTCCAGG + Intergenic
1154489343 18:14907676-14907698 CTGTCCAAACAGCTACATCCGGG - Intergenic
1156928661 18:42614730-42614752 CTGTCTACACAGCTGCATCCTGG + Intergenic
1157315914 18:46589473-46589495 GTGTCCACTCACCTGCATCCTGG - Intronic
1159942992 18:74422833-74422855 ATGTACACACATCTGCAGCTTGG - Intergenic
1161371994 19:3917765-3917787 CTGCACACACCTCTCCCTCCTGG - Exonic
1162871783 19:13591819-13591841 CTGTTCACCCATCTGCATAAGGG + Intronic
1163171524 19:15534850-15534872 ATTTTCACACATCTGCATCAAGG - Intronic
1163605293 19:18271672-18271694 CTGTTCCCACATCTGCACCCTGG - Intronic
1164478134 19:28590907-28590929 CTGTATACATATCTCCATTCTGG + Intergenic
1164679593 19:30124833-30124855 GTGTACACACATCTGCTTCCTGG + Intergenic
1164836921 19:31361774-31361796 CTGCACTCACCTCTGCCTCCTGG + Intergenic
1165127891 19:33613653-33613675 CAGAACACACTTCTGCAGCCAGG + Intergenic
1165467161 19:35981752-35981774 CTGTACACATCACTGGATCCTGG + Intergenic
1168628151 19:57935067-57935089 CTGTTCACAGGTCTGCAGCCCGG - Intronic
925233445 2:2256148-2256170 CTGTGCTCACATCTACAGCCCGG - Intronic
927422783 2:22950404-22950426 CTGGAACCACATCTGCTTCCTGG + Intergenic
930754570 2:54961485-54961507 CTGAACAAAAATCTGCTTCCTGG - Intronic
932070927 2:68619368-68619390 CTGCATCCACATCTACATCCAGG + Intronic
934512494 2:94956994-94957016 CTTCACAGACAACTGCATCCAGG + Intergenic
934818058 2:97347680-97347702 CTGTGGACACCTCTGCCTCCTGG + Intergenic
934819638 2:97360805-97360827 CTGTGGACACCTCTGCCTCCTGG - Intergenic
944895733 2:204162179-204162201 CTGTAAAAACATCTGGATCAGGG - Intergenic
946575292 2:221069194-221069216 CTGTAAACAAATGTGCATCCAGG - Intergenic
946903739 2:224396449-224396471 CTGCACACACGCCTCCATCCTGG + Intronic
1170164120 20:13344536-13344558 CTGTACAGATATCTGTACCCAGG + Intergenic
1170906025 20:20515870-20515892 CTGCAGACACATCTGCCTCATGG + Intronic
1172304883 20:33873710-33873732 CTGCACACACCTCTGAACCCTGG - Intergenic
1173269649 20:41521086-41521108 CTGTACACAGATCTGCCTTTAGG + Intronic
1180042219 21:45286829-45286851 CCGTGCACACCTCTGCGTCCAGG + Intronic
1180590121 22:16930343-16930365 CTGTATGCACCTCTGCCTCCTGG + Intergenic
1182615703 22:31588180-31588202 CTTCACACACATCTAGATCCTGG + Intronic
1183705699 22:39473856-39473878 CTGCCCACACACCTCCATCCAGG - Intronic
1184884041 22:47331398-47331420 CTGCACCCCCATCTGCATCTTGG + Intergenic
949896837 3:8774043-8774065 CTGTACCCACTTCTGCCTCTGGG + Intronic
952052645 3:29404020-29404042 CTGTACAGACACCAGTATCCTGG + Intronic
953635825 3:44663318-44663340 GTTTCCACAAATCTGCATCCAGG + Intergenic
954865993 3:53730353-53730375 CGCCACACACCTCTGCATCCCGG - Intronic
957891836 3:86369311-86369333 CTGTACACACAGCTGCACACAGG - Intergenic
960371924 3:116851045-116851067 CTGTACAGACTTCTGCTTCTGGG - Intronic
960696930 3:120405629-120405651 CTGTGCACACATCTGCAGTGGGG - Intronic
961098186 3:124175492-124175514 CTGTACACATTTCCCCATCCTGG - Intronic
961098212 3:124175624-124175646 CTGTACACATTTCCCCATCCTGG - Intronic
961098228 3:124175712-124175734 CTGTACACACTTCCACATCCTGG - Intronic
961476485 3:127150050-127150072 CTGTACACCCCTCTCCATCCTGG - Intergenic
962361708 3:134748655-134748677 CTGGACACACACCAGCATACAGG - Intronic
963916394 3:150862444-150862466 CTGTAGTCACCTCAGCATCCTGG - Intergenic
967477259 3:189936407-189936429 CTGTGCTCACATTTGCCTCCAGG + Intergenic
968385561 4:133765-133787 CTGTACATACATGTGCAACCTGG + Intronic
968927306 4:3556326-3556348 CTGAACTCCCATCTGCCTCCCGG + Intergenic
969245349 4:5928506-5928528 CAGCACACAGATCTGCCTCCTGG - Intronic
970876704 4:20879077-20879099 CTGTGCATTCATCCGCATCCTGG + Intronic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
975811420 4:78174060-78174082 CTGAACACACAGCTGAATCCGGG + Intronic
978604555 4:110465114-110465136 CTTTACCCACATCCACATCCAGG - Intronic
983674307 4:170273979-170274001 CTGGAAACTCATATGCATCCTGG + Intergenic
984154536 4:176178516-176178538 CTGTAGCCAAACCTGCATCCAGG + Intronic
986018861 5:3782076-3782098 CTGTATACACATTTGCAACTTGG + Intergenic
990182276 5:53174408-53174430 GTGTTCACACCACTGCATCCTGG + Intergenic
995659042 5:114460800-114460822 ATGTACATACATATGCATCATGG + Intronic
997475694 5:134141141-134141163 GTGCACACACATCTGCACACGGG - Intronic
997645645 5:135479982-135480004 CTGTCAACACTTCTGCATCATGG + Intergenic
997832556 5:137163536-137163558 CTGCACATACATTTGTATCCAGG - Intronic
998069772 5:139188034-139188056 CTGTACAGACTTCTGCTTCTGGG - Intronic
999038321 5:148378758-148378780 CTGTACAGGCTTCTGCTTCCTGG + Intergenic
1000877857 5:166663371-166663393 CTGAAAACACATTTTCATCCTGG + Intergenic
1001013157 5:168116844-168116866 GTGTACACACATCTACAACCCGG - Intronic
1001261027 5:170228839-170228861 CTGTGCCCTCATCAGCATCCAGG - Intergenic
1001340515 5:170839273-170839295 CTGTCAGCACCTCTGCATCCAGG - Intergenic
1002104918 5:176875273-176875295 CTGTACACCCAGCTGCCTCCTGG + Intronic
1004920401 6:20370527-20370549 TTGTTCACACATCAGCCTCCTGG - Intergenic
1005401185 6:25436361-25436383 CTGTATACACTTCTGCCTGCTGG - Intronic
1007229117 6:40335926-40335948 GTGTACACACATCTGCAATGCGG + Intergenic
1009039220 6:58157515-58157537 CTGTAGTCACATCTGCATTATGG + Intergenic
1012125393 6:95421763-95421785 CTGTACAGACTTCTGCTTCTGGG + Intergenic
1014659839 6:124156155-124156177 CTGTTCCCTCATCTCCATCCTGG - Intronic
1015292041 6:131548153-131548175 CTTTACCCAGATCTGCATCTAGG - Intergenic
1018095709 6:160385562-160385584 CTCAACACACACCTGCACCCAGG + Intronic
1022624909 7:32025335-32025357 CTCTACACCCATCTGGACCCTGG - Intronic
1024019856 7:45358621-45358643 CTGTATAAACATTTGCATACAGG - Intergenic
1028828194 7:95298594-95298616 CGATACACACATGTGCTTCCAGG + Exonic
1029651564 7:101896297-101896319 CTGTTCCCACACCTGCTTCCTGG - Intronic
1031703341 7:124952741-124952763 CAGAACATACATCCGCATCCAGG + Intergenic
1031713345 7:125076278-125076300 CTGTACAGACTTCTGCATCTAGG - Intergenic
1033331408 7:140420050-140420072 CTGTCCCAACATCTGCTTCCTGG - Intronic
1033483155 7:141761490-141761512 CTATCCACACATCTCCATGCAGG - Intronic
1034466646 7:151233636-151233658 CACTACACACATCTGCAGACTGG - Exonic
1035623119 8:1049890-1049912 GTGTACACACATGTGCAGGCAGG + Intergenic
1036665729 8:10736206-10736228 CTGTACACACGTCTGACTTCTGG + Intronic
1037381004 8:18285033-18285055 TTATACACACATCTGCATTTGGG + Intergenic
1037419414 8:18686613-18686635 CTGTACAGACCTCAGCATCCAGG + Intronic
1037654022 8:20867608-20867630 GTCAACAGACATCTGCATCCAGG - Intergenic
1042526905 8:69773193-69773215 ATGCACACACAGCTGCATGCAGG + Intronic
1042581196 8:70280986-70281008 TGGTGTACACATCTGCATCCTGG + Intronic
1043143982 8:76628191-76628213 CTATACACATATATGCATGCAGG - Intergenic
1047280178 8:123438838-123438860 CAGTACACAGAGCTGCTTCCTGG + Intronic
1048911615 8:139140789-139140811 GTGTACACACATGTGCATGTAGG + Intergenic
1049150243 8:141030492-141030514 CAGTACAGACAGCTCCATCCTGG + Intergenic
1049222977 8:141436282-141436304 TTCTACCCACAACTGCATCCTGG + Intergenic
1049546503 8:143234148-143234170 CTGCACACTCATGTGCACCCAGG - Intergenic
1051165752 9:14260606-14260628 CTGTGCATATATCTGCATGCAGG - Intronic
1051991369 9:23156182-23156204 CTGTACCCAAATCTGAATGCAGG + Intergenic
1054143041 9:61543553-61543575 CTGAACTCCCATCTGCCTCCTGG - Intergenic
1054462748 9:65474434-65474456 CTGAACTCCCATCTGCCTCCCGG - Intergenic
1057307576 9:93921081-93921103 CTGTCCACCCATGTGCCTCCAGG - Intergenic
1059757750 9:117309750-117309772 CTCTACACCCAGCTGCTTCCAGG - Intronic
1060509369 9:124220992-124221014 CTGAACACACATACGCTTCCAGG - Intergenic
1060510165 9:124225982-124226004 ATGTATACACATATGCATGCAGG - Intergenic
1061622536 9:131820769-131820791 CTGCACACACATCAAAATCCAGG - Intergenic
1062503552 9:136861531-136861553 ATGAACACACATCTGCCCCCAGG + Intronic
1062546914 9:137067977-137067999 CTGTACCCACTTCTGTAGCCTGG - Intronic
1185487267 X:491582-491604 CTGTACACATATATGCATATGGG - Intergenic
1185487284 X:491790-491812 CTGTACACATATATGCATATGGG - Intergenic
1185487297 X:492007-492029 CTGTACACATATATGCATATGGG - Intergenic
1185487308 X:492112-492134 CTGTACACATATATGCATATGGG - Intergenic
1185487317 X:492218-492240 CTGTACACATATATGCATATGGG - Intergenic
1185487343 X:492543-492565 CTGTACACATATATGCATATGGG - Intergenic
1185487377 X:493074-493096 CTGTACACATATATGCATATGGG - Intergenic
1191001482 X:55664083-55664105 CTGTACACCCCTCTCCAGCCTGG - Intergenic
1193257929 X:79371374-79371396 CTGTACACATAGCTTGATCCTGG + Intergenic
1199071416 X:143479851-143479873 CTGTACCAACATCAGTATCCTGG - Intergenic
1200830129 Y:7680957-7680979 CTGTACCCACTTCTGCAGTCCGG + Intergenic
1202379343 Y:24262138-24262160 CTACACACACATCTCCTTCCTGG + Intergenic
1202491439 Y:25407983-25408005 CTACACACACATCTCCTTCCTGG - Intergenic