ID: 1122854690

View in Genome Browser
Species Human (GRCh38)
Location 14:104554442-104554464
Sequence CTTAGGGAACAGCAGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122854690 Original CRISPR CTTAGGGAACAGCAGGACAG AGG (reversed) Intronic
900422955 1:2563486-2563508 CTCAGGCCACAGCAGAACAGAGG - Exonic
900516312 1:3083836-3083858 CCCAGGGAACTGCAGGAGAGAGG + Intronic
900974945 1:6011158-6011180 CTGAGGGAGCAGCAGGAGTGAGG + Intronic
901427355 1:9190891-9190913 ATCAGGGAACAGGAGGAAAGGGG - Intergenic
901810190 1:11763005-11763027 CAGAGGGGACAGCAGCACAGAGG + Intronic
901863612 1:12089966-12089988 GTTAGGGAACAGTAGGTGAGTGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906693064 1:47805484-47805506 CTAAGGAAAAAGAAGGACAGGGG - Intronic
907148273 1:52256864-52256886 CTTTGTGAACAGCTGGACACTGG + Intronic
909594021 1:77384861-77384883 ATTAGTGAATAGCAGGACTGAGG + Intronic
910425107 1:87113788-87113810 CTGAGAGATCAGCAGGGCAGTGG + Intronic
913053068 1:115133751-115133773 CTGAGGGAAGACCAGGGCAGAGG + Intergenic
914820070 1:151094680-151094702 ATCAGGGAACAATAGGACAGGGG + Intronic
915021058 1:152778672-152778694 CTTAGGGAGCCACAGGACAAGGG - Intronic
915153630 1:153856020-153856042 AGCAGGGAACAGCAGGACAATGG - Intronic
915705985 1:157844261-157844283 CTTAGAGAAGATCAGGACATGGG + Intronic
915818890 1:159000059-159000081 CTTCGGGAAGAGCAGGAAACAGG - Intronic
918315685 1:183320840-183320862 TTTTGGCAACAGCAGGACAGAGG - Intronic
919159457 1:193809213-193809235 CTTATGTGACAGCAGGAGAGAGG + Intergenic
919450270 1:197763749-197763771 CTTAGGGAACAGTAGAGGAGTGG - Intronic
920714946 1:208331474-208331496 CATTTGGAACAGCAGGACAGGGG - Intergenic
921445430 1:215241732-215241754 CTTAGGGTGTGGCAGGACAGAGG - Intergenic
921931683 1:220759670-220759692 CTTAGGGAACTGCTGAACAGTGG + Intronic
923062255 1:230486857-230486879 CTCAGGGAAAAGGAAGACAGTGG + Intergenic
924258759 1:242208725-242208747 CTTGGGGTACAGGAGCACAGGGG - Intronic
1064273914 10:13889975-13889997 TTTAGGGCACAGCAGGAATGAGG - Intronic
1068134330 10:52936849-52936871 ATGAGGGAAAAGCAGGAAAGGGG + Intergenic
1069619585 10:69828523-69828545 CTGAAAGAAAAGCAGGACAGCGG - Intronic
1069714084 10:70509530-70509552 CTTAGGAAACACCAGGCCACCGG + Intronic
1069818733 10:71214649-71214671 CTTTTGTACCAGCAGGACAGTGG + Intronic
1070706837 10:78645922-78645944 CTTAGGGAACAGGGGGAAGGAGG - Intergenic
1071172150 10:82878941-82878963 CTGAGGGAAAGGCAGGACAAAGG - Intronic
1072506484 10:96072884-96072906 CTCATAGAACAGGAGGACAGAGG - Intergenic
1072549277 10:96465094-96465116 CTCAGGGAACTGGAGGAGAGAGG + Intronic
1073034423 10:100553284-100553306 CTTAGGGATCAGTAGTTCAGGGG + Exonic
1073818847 10:107237056-107237078 CTGAGGGACCAGCAGGAAAGGGG + Intergenic
1076540433 10:131211102-131211124 CTTTGGGGACAGCAGCAAAGGGG + Intronic
1077155285 11:1088350-1088372 CTTCGGGAACAGCTGGAAGGAGG + Intergenic
1077373593 11:2195060-2195082 CTCAGGGAACACCAGGGAAGGGG - Intergenic
1077478504 11:2802266-2802288 CTTTGAGGGCAGCAGGACAGGGG + Intronic
1077501916 11:2913154-2913176 CTGAGGGAGCAGCAGGATATGGG + Intronic
1078483830 11:11703997-11704019 CAAATGGGACAGCAGGACAGGGG - Intergenic
1078584302 11:12567947-12567969 ATGAGGGAATAGCAGGTCAGTGG + Intergenic
1079098005 11:17523268-17523290 CTGTGGGGACAGAAGGACAGTGG + Intronic
1079348331 11:19672100-19672122 CTGAGGGAACAGCAAGCCAGGGG + Intronic
1083177645 11:60961415-60961437 CCTAGGCTACAGCATGACAGTGG + Intergenic
1083719533 11:64597605-64597627 CTTAGGGATTTGCAGAACAGAGG - Intronic
1083794425 11:65006684-65006706 GTGAGGGCACAGCAGGACACGGG + Intergenic
1083795855 11:65016291-65016313 CAAAGGGAACAGCAAGTCAGAGG + Intronic
1084572718 11:69969216-69969238 CTTTGGGGACAGCAGGAGAAGGG - Intergenic
1084682214 11:70673074-70673096 GTCAGGAAACATCAGGACAGGGG - Intronic
1087005667 11:93468272-93468294 CTCAGGGTACAGCAGTGCAGTGG + Intergenic
1091036485 11:132238343-132238365 GTTTGGGACCAGCAGAACAGAGG - Intronic
1091798226 12:3309232-3309254 CTTAAGGAACACAAGGAGAGGGG + Intergenic
1092253657 12:6915058-6915080 CGTGGGGAAGAGCAGGAGAGAGG - Intronic
1092444803 12:8544757-8544779 CTTAGGCATCACCTGGACAGGGG - Intergenic
1093310732 12:17579795-17579817 CTTAGAGAGAAGCAGCACAGAGG + Intergenic
1093464586 12:19436964-19436986 GATAGGAGACAGCAGGACAGAGG - Intronic
1093700677 12:22216684-22216706 CTTAGGGAACAGCAAGATAAAGG - Intronic
1095508099 12:42920018-42920040 ATGAGGGAACAGTAGGTCAGAGG + Intergenic
1096415505 12:51408787-51408809 CTTGAGGAACAGCAGGGAAGAGG - Intronic
1101125058 12:101624806-101624828 CTTTGGGAAGAGCAGAGCAGAGG + Intronic
1101436656 12:104670056-104670078 CTAAGCCAACAGCTGGACAGAGG + Intronic
1102626924 12:114242548-114242570 CTTTGCGAAAAGCAGGACTGAGG + Intergenic
1103181699 12:118917907-118917929 TTTAGGGAGCCACAGGACAGAGG + Intergenic
1105001120 12:132689394-132689416 CACAGGGAACAGCAGGGCAAAGG + Intronic
1106576081 13:30976882-30976904 CTTAGAGAACAGCAAGGCAAGGG + Intergenic
1106642838 13:31602215-31602237 CTAAGGCAACAGTGGGACAGGGG + Intergenic
1106861373 13:33912518-33912540 CCTGGGGAACATCAGGGCAGTGG + Intronic
1107631704 13:42349744-42349766 CTTAGGAATCATCAGTACAGAGG - Intergenic
1107935577 13:45342676-45342698 CTTGGGAAAGAGCAGGACACAGG + Intergenic
1111033603 13:82640142-82640164 CTTAGGAAAAAGAAGGCCAGAGG + Intergenic
1112029543 13:95444456-95444478 CTCAGGGAGGAACAGGACAGGGG + Intronic
1112127414 13:96483390-96483412 CTTAGAGAACAAGAGGGCAGTGG + Intronic
1113391625 13:109903400-109903422 CTGAGGGAATAGCAGGAGAGAGG + Intergenic
1117070178 14:52049052-52049074 CTCAGGGCACAGCAGGAGGGTGG + Intronic
1118138139 14:63050222-63050244 CTTTGGGAACAGGAGATCAGAGG + Intronic
1118342444 14:64906156-64906178 GGTAGGGAGCAGCAGGACACGGG + Intergenic
1119860729 14:77934087-77934109 TCTAGGGAACAGAAGGCCAGGGG + Intronic
1120529369 14:85613740-85613762 CTTACAGAGAAGCAGGACAGAGG + Intronic
1121898794 14:97673299-97673321 TTTAGGGCACAGCAGAGCAGAGG + Intergenic
1122649277 14:103216754-103216776 GTCAGAGAACAGCAGGGCAGGGG + Intergenic
1122854690 14:104554442-104554464 CTTAGGGAACAGCAGGACAGAGG - Intronic
1122954625 14:105064913-105064935 CAGAGGGAAAAGCAGGGCAGTGG - Intronic
1126172943 15:45709168-45709190 CATAGAGAACAGGAGGCCAGAGG + Intergenic
1128329887 15:66748725-66748747 GTTAGGGAACAGCAGGGAAGGGG - Intronic
1128896369 15:71377384-71377406 CCTAGGAGACAGCAGGAAAGGGG + Intronic
1129684026 15:77674606-77674628 CAGAGGGAACAGCAGGTCTGAGG - Intronic
1131611624 15:93970325-93970347 TTTCGGGAGGAGCAGGACAGGGG + Intergenic
1131897643 15:97051314-97051336 CTTGGGGGACAGTAGGAGAGAGG + Intergenic
1132196025 15:99915459-99915481 CCCAGGGAATAGCAGGACATTGG + Intergenic
1133248597 16:4465386-4465408 CTGAGTGACCAGCAGGACACAGG + Intronic
1134872749 16:17666691-17666713 CTTAGAGAAGTGCAGGTCAGAGG + Intergenic
1135377435 16:21960776-21960798 CTTGGGGAGCAGCTGGTCAGTGG + Intronic
1136631336 16:31490762-31490784 CTTTGGCCACAGCAGGACAGGGG - Exonic
1139191754 16:64872002-64872024 CTTAGGACACAAGAGGACAGAGG + Intergenic
1139549986 16:67667672-67667694 TGTAGGGAGCAGCAGGAGAGTGG + Intronic
1140510653 16:75505368-75505390 TTTTGTGTACAGCAGGACAGTGG - Intergenic
1141666732 16:85469669-85469691 CTCAGGGAGCAGCAGGACCCAGG - Intergenic
1141915198 16:87091693-87091715 GTTAGGGAACAGAGGTACAGAGG - Intronic
1142974790 17:3636873-3636895 CTTGAGGCACAGCAGGTCAGCGG + Intronic
1143341654 17:6215891-6215913 GGAAGGGACCAGCAGGACAGTGG + Intergenic
1144322703 17:14145533-14145555 CTTAGAGTACAGCATGAAAGAGG + Intronic
1144560587 17:16317666-16317688 CTCAGGGCAGGGCAGGACAGTGG - Intronic
1145868389 17:28255271-28255293 CCCAGAGAGCAGCAGGACAGGGG + Intergenic
1146055553 17:29579009-29579031 CAGAGGGAAGAACAGGACAGAGG + Intronic
1146944762 17:36866073-36866095 GTTAGGGAATAGCAGGACCAGGG + Intergenic
1147052286 17:37804239-37804261 CAAATGGAACAGCAGGCCAGTGG + Intergenic
1147866942 17:43559456-43559478 CTTAGGGAATATCAGGACCAAGG + Intronic
1148130342 17:45258362-45258384 CTGGGGGAACAGCAGGACCTGGG - Intronic
1151800860 17:76378869-76378891 CTAAGGGTACAGGAGGAAAGGGG - Intronic
1152708704 17:81859554-81859576 CTTGGGCAATATCAGGACAGAGG + Intronic
1153699002 18:7673828-7673850 CATTGGGAACAACAGGACTGAGG + Intronic
1155051230 18:22149524-22149546 GTTGTGGAACAGAAGGACAGGGG + Intergenic
1156601374 18:38611191-38611213 CTTAAAGAAAAGCAGAACAGAGG + Intergenic
1157917880 18:51686780-51686802 CTTAGGGGACCGCTGGGCAGGGG - Intergenic
1159102987 18:63975869-63975891 CTTAGAGCACAGGAGGAAAGGGG - Intronic
1160559020 18:79744887-79744909 CTTGAGGAAGAGCAGGCCAGAGG + Intronic
1161345933 19:3768729-3768751 CTTGGGGAACAACAGGAGGGTGG - Intergenic
1162344693 19:10112403-10112425 CCCAGGGCACAGCAGCACAGGGG - Intronic
1162818409 19:13209271-13209293 CTCAGGGACAAGCAGAACAGAGG - Intronic
1163049765 19:14673870-14673892 CTGAGGGAGTAGAAGGACAGTGG - Intronic
1163685384 19:18709300-18709322 ATGAGGGGACATCAGGACAGAGG - Intronic
1164439693 19:28264233-28264255 CTTAAGGAACAGTATGACATGGG + Intergenic
1166800753 19:45455752-45455774 CTGTGGGAACAGCAGGGCTGGGG - Intronic
1167267083 19:48488593-48488615 CTCAAGGAACAGAAGGACACTGG - Intronic
1167853732 19:52221274-52221296 CTTGGGGAACTGCAGGCAAGGGG + Intronic
1168268755 19:55238332-55238354 CTTAGTCCACAGCTGGACAGAGG - Intronic
925028791 2:633466-633488 CTTAGGAAACGGAAGGACATTGG - Intergenic
927270162 2:21198884-21198906 GGCAGGGAAGAGCAGGACAGAGG - Intergenic
930273836 2:49288389-49288411 CTGAGGGAAGAGCAGGAGAGAGG - Intergenic
930595239 2:53379635-53379657 CTTAGGGCACAGAAAGAAAGTGG - Intergenic
932880090 2:75493218-75493240 ATTAGGGAGCAGCAGGACCCCGG - Exonic
935918424 2:107984410-107984432 CTTAGGGAACTACATGTCAGTGG - Intergenic
937774269 2:125757223-125757245 CTTATGTAGCATCAGGACAGTGG + Intergenic
939728913 2:145757365-145757387 CTTAGGAAAGGGCAGGGCAGGGG - Intergenic
940971302 2:159899782-159899804 CTGAGGGAGCAGCAGAACAGTGG + Intronic
940992582 2:160112717-160112739 CTCAGGGACCAGCAGGATAAAGG + Intronic
942393820 2:175524859-175524881 TTTAGGGAAGAGCAGAAAAGGGG + Intergenic
942536945 2:176974998-176975020 CTTAGGGAGCAGCATGATAAGGG - Intergenic
944079169 2:195766409-195766431 CTTTGGGAACCGGAGGCCAGTGG - Intronic
945008851 2:205440392-205440414 CTAAGGGAAAAGCAGGCAAGAGG + Exonic
945219284 2:207467734-207467756 GTTACAGAAAAGCAGGACAGAGG - Intergenic
945490103 2:210444493-210444515 TTAAGGGAACTGCAGGAAAGTGG + Intronic
945912893 2:215669622-215669644 CTTGGGTAAGAGCAGGGCAGGGG - Intergenic
946311387 2:218884131-218884153 TAAAGGGAACAGGAGGACAGAGG - Intronic
947134949 2:226968043-226968065 GTTATGCAAGAGCAGGACAGAGG - Intronic
947722205 2:232376974-232376996 CTCAGGGGACAGCATGGCAGGGG + Intergenic
948113617 2:235477125-235477147 CTTGAGGAAAAGCTGGACAGAGG + Intergenic
948669693 2:239559873-239559895 CTGGGGTCACAGCAGGACAGTGG + Intergenic
1169157171 20:3341472-3341494 CATAGGGAACATCATCACAGAGG - Intronic
1172504380 20:35450638-35450660 CTAAGGGAACTGCAGGAGAGGGG - Intronic
1172838180 20:37886396-37886418 CTGAGGGCACTGCAGGGCAGGGG - Intergenic
1173625254 20:44467624-44467646 CTTAGGGAACCCCAGGCCCGGGG + Intergenic
1173835070 20:46119432-46119454 CTTAGGGAACAGGGAGGCAGGGG + Intronic
1173842303 20:46165884-46165906 CATAGGGAGCAGAAGGGCAGTGG - Intergenic
1175303663 20:57961005-57961027 CACAGGGAAAAGCAGCACAGAGG + Intergenic
1175761787 20:61566212-61566234 GGTGGGAAACAGCAGGACAGCGG - Intronic
1176199125 20:63852332-63852354 CTTAGGGACCAGGAGGAATGAGG - Intergenic
1176304996 21:5118641-5118663 CTCAGGGACAAGCACGACAGCGG + Intronic
1178972695 21:37195046-37195068 CTAGGGGAAGAGCAGGACTGGGG + Intronic
1178985375 21:37298645-37298667 CCCAGGGGACAGCAGAACAGGGG - Intergenic
1179175746 21:39006725-39006747 CCTGGGGGCCAGCAGGACAGAGG - Intergenic
1179644640 21:42767895-42767917 CCTAGGGAACAGCAGAAAATAGG + Intronic
1179852059 21:44143389-44143411 CTCAGGGACAAGCACGACAGCGG - Intronic
1180621133 22:17162930-17162952 GTTAAGCAACAGCAGGGCAGGGG - Intronic
1182265233 22:29109530-29109552 GTCAGGGAACAGCAGGACAGAGG + Intronic
1183270431 22:36859113-36859135 CTGAGGGAAGAGGAGGACATTGG - Intergenic
1183405644 22:37629439-37629461 CTGAGGGGAAAGCAGGAGAGAGG - Intronic
1183579643 22:38716257-38716279 CTTTGGGAAGAGCACGAGAGAGG + Intronic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184445520 22:44544782-44544804 CTCAGGTATCAGCAGGACATGGG - Intergenic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
949145143 3:690898-690920 CTTGGAGAGCAGCTGGACAGTGG - Intergenic
951887159 3:27535555-27535577 CATTTGGAACACCAGGACAGAGG - Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
952916627 3:38250818-38250840 CAGAGGGAACAGGAGGACTGCGG - Intronic
953907364 3:46874979-46875001 CCTTGGGAACAGCAGGGCTGGGG + Intronic
954238639 3:49276453-49276475 CTTGGAGAACTGCAGGAGAGGGG - Exonic
955236039 3:57140176-57140198 CTTGGGGAACATCAAGACATGGG - Intronic
955982349 3:64539744-64539766 CCTAGGCAACAGGAGGACAGAGG - Intronic
957871233 3:86092719-86092741 CTCAGGGAAAAGTGGGACAGTGG + Intergenic
960294474 3:115926356-115926378 CTTAGAGAACATAAGAACAGAGG + Intronic
961288234 3:125824068-125824090 CTCAAGGAACAGCAGGCCTGAGG - Intergenic
962864778 3:139439025-139439047 ATTATGGAACAGCATGAAAGAGG + Intergenic
965308885 3:167103189-167103211 CTTGGGGTAGAGCAGGAAAGAGG - Intergenic
966433711 3:179860293-179860315 CTTGGGGAATAGGAGGAGAGGGG + Intronic
967151516 3:186654605-186654627 GTTAGGGAACACCAAGTCAGTGG - Intergenic
967563221 3:190942154-190942176 ATCAGAGAACAGCAGGAGAGAGG + Intergenic
968186899 3:196639390-196639412 CTTTGGGAACGGCAGCACCGTGG - Intergenic
969244702 4:5924847-5924869 ATTACAGAACAGCAGGTCAGAGG + Intronic
969378614 4:6779728-6779750 CTTAGTGAACAGCAGGGATGAGG - Intergenic
969621462 4:8280931-8280953 CTTGGGGAGCTGCAGGGCAGAGG + Intronic
971176989 4:24291649-24291671 CTTCGGGATCAGCAGGACTTCGG - Intergenic
971709060 4:30088018-30088040 ATTAGGGAACAGCAAATCAGTGG + Intergenic
973711246 4:53632227-53632249 TTCAGGGACCACCAGGACAGTGG + Intronic
973886141 4:55324115-55324137 CTAATAGAACAGAAGGACAGAGG + Intergenic
974939930 4:68454727-68454749 CTAAGGAAACAGCAAGCCAGAGG + Intronic
978008295 4:103646902-103646924 CTTAGGGAACAGTATGATATAGG + Intronic
978799278 4:112739658-112739680 CTAAGGGAACATCAGGAAATGGG - Intergenic
979434049 4:120668116-120668138 GTAATGGGACAGCAGGACAGAGG - Intergenic
979463604 4:121010727-121010749 CTTTGGGAATAGCTGGACATGGG + Intergenic
979598827 4:122564085-122564107 GTTAAGGAAAAGCAGAACAGAGG - Intergenic
985695307 5:1336831-1336853 CTGAGGGAACAGCAGTACAGGGG + Intronic
987381357 5:17288855-17288877 CAGAGGGAACAGCTGGACAAAGG + Intergenic
988133973 5:27144769-27144791 CTTAGGGAACTTCAGGGCAAAGG - Intergenic
989166769 5:38440157-38440179 CAGAGGGAACTGCAGGACATTGG + Intronic
990298054 5:54422991-54423013 TTTAGGGAACTCAAGGACAGAGG + Intergenic
990780658 5:59358432-59358454 CTTTGAGAACACCAGGAAAGTGG - Intronic
992386275 5:76287631-76287653 CAGAGGGAACAGCAGCACTGTGG - Intronic
992741104 5:79774412-79774434 CTGAGGAAACAGCAGAACGGTGG - Intronic
992813005 5:80408189-80408211 CTGTGGGAACAGCAGGGCTGAGG - Intronic
994151721 5:96455657-96455679 CTGAGGGAACGGCAGGACTGAGG - Intergenic
994384606 5:99115451-99115473 ATGAGGAAAAAGCAGGACAGGGG + Intergenic
995777368 5:115738350-115738372 CCTAGGAAATAGCAGAACAGTGG + Intergenic
996712688 5:126559261-126559283 CTGTGGGAACAGCTGGCCAGAGG - Exonic
996784038 5:127218964-127218986 ATGAGGGAAGGGCAGGACAGGGG + Intergenic
996834618 5:127777061-127777083 CTCAGGGATCTGGAGGACAGTGG - Intergenic
997568199 5:134905293-134905315 CTGAGGGACCAGCGGGACTGGGG + Intronic
998037052 5:138926312-138926334 GTGAGGAAACAGCAGGGCAGAGG - Intronic
998443170 5:142178965-142178987 CTCAGGCACCAGCAGGAGAGGGG - Intergenic
998487113 5:142512508-142512530 CTGAGGGAGCAAAAGGACAGAGG - Intergenic
1006573740 6:35027411-35027433 CTTAGGGGACATCAGGGTAGAGG + Intronic
1007249006 6:40482962-40482984 CCAAGGGAACAGAGGGACAGTGG - Intronic
1008556938 6:52681580-52681602 CTGAGGGCACAGCAGTGCAGTGG - Intronic
1010099851 6:72091157-72091179 CTGAGGTAAAAGCAGGGCAGAGG - Intronic
1014333202 6:120096898-120096920 CTTAGGGATCACCAAGAGAGAGG + Intergenic
1014786706 6:125627712-125627734 CTTAAGGGACAGAAGGACAGGGG + Intergenic
1017208265 6:151826944-151826966 CTGAGGGCACAGCAGGGAAGAGG + Intronic
1022653384 7:32297433-32297455 TTTGGAGAACAGCAGGATAGAGG - Intronic
1022821027 7:33961191-33961213 GTTTGGGAACAGCAGAATAGAGG + Intronic
1023178559 7:37457617-37457639 CTTGGCAAACAGCAGGAAAGTGG - Intergenic
1027760664 7:82275233-82275255 TTTAGGGAACTACATGACAGAGG - Intronic
1029068770 7:97877983-97878005 CTCAAGGAACAGCAGGCCTGGGG + Intergenic
1032285789 7:130537583-130537605 CATATGGGAGAGCAGGACAGAGG + Intronic
1032286552 7:130542009-130542031 CATATGGGAGAGCAGGACAGAGG + Intronic
1032701601 7:134385161-134385183 GTCAGGGAACAGCCGGTCAGTGG - Intergenic
1034901755 7:154912032-154912054 CTCAATGACCAGCAGGACAGCGG + Intergenic
1036251080 8:7163171-7163193 CTTGAGGAACAGCAGGCCTGGGG + Intergenic
1036366408 8:8124289-8124311 CTTGAGGAACAGCAGGCCTGGGG - Intergenic
1036583398 8:10099858-10099880 CTTTGGGAAAATGAGGACAGAGG - Intronic
1037085084 8:14838583-14838605 CTAAGGGAAAAGCAAGGCAGGGG - Intronic
1037447689 8:18983582-18983604 CTCAGGGAATAGCGGGACAGGGG + Intronic
1037987454 8:23298947-23298969 CCTAGGGAGAAGCAGGGCAGAGG + Exonic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1041860833 8:62510863-62510885 CACAGGAAAAAGCAGGACAGAGG - Intronic
1043038268 8:75226220-75226242 CTTAGCTAACACCAGGAAAGTGG + Intergenic
1043963345 8:86443803-86443825 CATAGGGAACAGCAAGACAAAGG + Intronic
1044540047 8:93398637-93398659 CTTGGGAAGCAGCAGGAAAGAGG - Intergenic
1044589288 8:93898292-93898314 CGGAGGGAAATGCAGGACAGAGG + Intronic
1044762442 8:95535802-95535824 CTTAGGGCACAGCAGGTGTGTGG - Intergenic
1045102281 8:98857039-98857061 CTTAGGGCAGGGGAGGACAGGGG + Intronic
1045649830 8:104331187-104331209 CTTGGGGAGCAGAAGGACATAGG - Intronic
1046617388 8:116492108-116492130 CTTTGGGAAAAGCTGGAGAGGGG - Intergenic
1046976365 8:120282846-120282868 GGAAGGGAACAGCAGGACACAGG + Intronic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1047727139 8:127693858-127693880 CTTAGGGGCCAGCAGGAGGGTGG - Intergenic
1049145117 8:140994781-140994803 CTCAGGGAATAGCAGGCCACAGG - Intronic
1049169048 8:141147098-141147120 GTGAGGGAAGAGCAGGCCAGCGG - Intronic
1049557375 8:143289684-143289706 CACAGGGAACAGCATGACACGGG + Intronic
1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG + Intronic
1051720863 9:20035859-20035881 TCTAGGGAACAGCAAGGCAGTGG - Intergenic
1051903588 9:22069179-22069201 CTTAGGGAGCTGCAAGACAGGGG - Intergenic
1052914642 9:33915354-33915376 CATATGGAACATTAGGACAGAGG + Intronic
1053306489 9:36987709-36987731 CATGGGGAAGAGCAGGAAAGGGG + Intronic
1055725857 9:79227975-79227997 CTTAGGGAAGAGCATGTCATTGG - Intergenic
1056742425 9:89269409-89269431 CTTAGGGAAAAGCTTGACATTGG - Intergenic
1056804522 9:89718337-89718359 CTCAGGGGACACCAGGACATTGG + Intergenic
1057264124 9:93602949-93602971 CTCAGGATACAGCAGGGCAGAGG + Intronic
1058164170 9:101601986-101602008 CTTATTGGACAGAAGGACAGAGG + Intronic
1058965741 9:110036809-110036831 CATAGGGAACAGCAGGTGTGGGG - Intronic
1059428417 9:114235689-114235711 CCAGGGGAACAGCAGGGCAGGGG - Intronic
1059502038 9:114763006-114763028 CTAAAGAAACAGCAGGCCAGGGG - Intergenic
1059682618 9:116600784-116600806 CTTAAGGAATAAAAGGACAGTGG - Intronic
1059777086 9:117486968-117486990 CGTGGGAGACAGCAGGACAGAGG + Intergenic
1060918695 9:127405818-127405840 CTTAGTGAACGTCAGGAAAGCGG + Intronic
1061798174 9:133100560-133100582 CATGGGGAACAGAAGGACGGAGG - Intronic
1062123611 9:134847838-134847860 GAGAGGGAACAGCAGGGCAGAGG + Intergenic
1062220126 9:135410583-135410605 CTTAGGGAACAGCTGGAGTTGGG - Intergenic
1062585868 9:137249689-137249711 CTCAGGGAACTTCTGGACAGGGG + Intergenic
1062652621 9:137586007-137586029 CCAAGGGACCAGCAGGATAGGGG - Intronic
1189640529 X:43065823-43065845 CTCAAGGAAAATCAGGACAGGGG - Intergenic
1195680372 X:107541438-107541460 CTTAGAGACCAACAGGACAAGGG + Intronic
1197571507 X:128156335-128156357 CTTAGGGAAGAGCTGGGCAGTGG + Intergenic
1197694922 X:129540408-129540430 CTCCGGGCTCAGCAGGACAGCGG - Exonic
1198532935 X:137563414-137563436 CTTTGTGAACAGCAGGTCAGAGG - Intergenic
1199421185 X:147646377-147646399 CTTATGGAAAAATAGGACAGAGG + Intergenic
1200255969 X:154583383-154583405 CTTAGGAAGCAGGAAGACAGAGG - Intergenic
1200261800 X:154621020-154621042 CTTAGGAAGCAGGAAGACAGAGG + Intergenic