ID: 1122854761

View in Genome Browser
Species Human (GRCh38)
Location 14:104554759-104554781
Sequence AGCTGTCACCCCAGCCCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 271}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122854750_1122854761 29 Left 1122854750 14:104554707-104554729 CCGGGGCCTCCCTCCTGCAATGC 0: 1
1: 0
2: 3
3: 29
4: 359
Right 1122854761 14:104554759-104554781 AGCTGTCACCCCAGCCCCCGCGG 0: 1
1: 0
2: 2
3: 27
4: 271
1122854759_1122854761 -10 Left 1122854759 14:104554746-104554768 CCAGCGAACGTCCAGCTGTCACC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1122854761 14:104554759-104554781 AGCTGTCACCCCAGCCCCCGCGG 0: 1
1: 0
2: 2
3: 27
4: 271
1122854755_1122854761 19 Left 1122854755 14:104554717-104554739 CCTCCTGCAATGCTGGCTGTGGG 0: 1
1: 0
2: 2
3: 34
4: 263
Right 1122854761 14:104554759-104554781 AGCTGTCACCCCAGCCCCCGCGG 0: 1
1: 0
2: 2
3: 27
4: 271
1122854752_1122854761 23 Left 1122854752 14:104554713-104554735 CCTCCCTCCTGCAATGCTGGCTG 0: 1
1: 1
2: 2
3: 70
4: 356
Right 1122854761 14:104554759-104554781 AGCTGTCACCCCAGCCCCCGCGG 0: 1
1: 0
2: 2
3: 27
4: 271
1122854757_1122854761 16 Left 1122854757 14:104554720-104554742 CCTGCAATGCTGGCTGTGGGTGG 0: 1
1: 0
2: 4
3: 29
4: 279
Right 1122854761 14:104554759-104554781 AGCTGTCACCCCAGCCCCCGCGG 0: 1
1: 0
2: 2
3: 27
4: 271
1122854753_1122854761 20 Left 1122854753 14:104554716-104554738 CCCTCCTGCAATGCTGGCTGTGG 0: 1
1: 0
2: 0
3: 35
4: 284
Right 1122854761 14:104554759-104554781 AGCTGTCACCCCAGCCCCCGCGG 0: 1
1: 0
2: 2
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122854761 Original CRISPR AGCTGTCACCCCAGCCCCCG CGG Intronic
900241507 1:1619654-1619676 TGCTCACATCCCAGCCCCCGGGG + Intronic
900431911 1:2606614-2606636 AGGTGCCACTCCTGCCCCCGGGG + Intronic
900970495 1:5989999-5990021 AGGTGTCACCTCGGCCTCCGTGG - Intronic
901447661 1:9318145-9318167 TGCTGTCAGCCCAGACCCCAGGG - Intronic
901631763 1:10651484-10651506 GGCCGTCACCCCAGCAACCGCGG - Intronic
901680057 1:10907896-10907918 AGCTGGGACCCCAGACCCAGAGG + Intergenic
902943078 1:19814491-19814513 TGCTGTCTCCCCAGCACCCGGGG - Exonic
902977385 1:20098739-20098761 AGCTGTGACCCCTGCCCTCTGGG - Intergenic
903068091 1:20712028-20712050 ATCTGTCACTGCAGCCCCCAAGG + Intronic
903260851 1:22131221-22131243 AGCTGTCTCCCCATCCCTGGAGG + Intronic
905501762 1:38445280-38445302 AGCTGCCACGCCAGCCCCCACGG + Intergenic
907468910 1:54658937-54658959 AGTTGTCCCCCCAACCCCCATGG - Intronic
910364285 1:86447594-86447616 AGCTGTGCCCCCAGCCACTGTGG + Exonic
912777702 1:112516235-112516257 AGCTGTGACCCCTACACCCGTGG + Exonic
915433968 1:155889179-155889201 AGCTGTCATCCCAGCACCTTGGG + Intergenic
915595593 1:156894756-156894778 GGCTGTGACCCTAGTCCCCGGGG + Intronic
916611231 1:166393900-166393922 AGCTCTCACCCCCACCCCCATGG + Intergenic
917978294 1:180254106-180254128 AGCTGTGCCCCCAGCCACTGGGG + Intronic
917978921 1:180257427-180257449 GGCTGTGTCCCCAGCCCCCGAGG + Intronic
919868409 1:201801578-201801600 AACTGTAACCCCAGCACCCAGGG - Intronic
920308045 1:205031438-205031460 AGCTGTGACCCCAACCTCCCTGG + Intergenic
920374646 1:205501306-205501328 CCCTGGCACCCCAGCCCCTGGGG - Intergenic
920881131 1:209881400-209881422 ATCTCCCAGCCCAGCCCCCGTGG + Intergenic
921266699 1:213426373-213426395 ACGTGCCACCCCAGTCCCCGAGG - Intergenic
923903632 1:238357655-238357677 GGCTTTCACGCCAGCCCCTGTGG + Intergenic
1062899707 10:1133820-1133842 GCATGTCACCCCAGCCCCCCGGG - Intergenic
1062939562 10:1411165-1411187 AGATGCCTCCCCAGCCTCCGTGG + Intronic
1063575930 10:7261985-7262007 CGCTGTCACCCCTGCCCCCAGGG - Intronic
1064110039 10:12530642-12530664 CGCTGCCTCCCCAGACCCCGAGG - Intronic
1064269066 10:13849020-13849042 AGATGTCTTCCCAGCCCCCAGGG - Intronic
1066130065 10:32384542-32384564 AGCTTTCACACCAGCCACTGAGG + Intergenic
1066455157 10:35565968-35565990 AGCTGCCACACCAGGCCACGTGG - Intronic
1069439939 10:68418930-68418952 ACCTGTAATCCCAGCCCCCTGGG - Intronic
1070824621 10:79384104-79384126 AGCGGGAACCCCAGCCCCCAAGG + Exonic
1072011971 10:91309985-91310007 ACCTGTGACCCCAGCCCTCCTGG + Intergenic
1072488634 10:95880927-95880949 AGGTGTCACCCCAGACAACGAGG - Intronic
1072716496 10:97756011-97756033 AGCTGTCTCCCCAGCCCACTTGG + Intronic
1073001459 10:100288996-100289018 AGCTGTGACCCCAGACCCCTGGG - Exonic
1075560127 10:123462039-123462061 AACTTTGATCCCAGCCCCCGAGG + Intergenic
1076406493 10:130215534-130215556 TCCTGTGACCCCAGCCCACGGGG - Intergenic
1077034523 11:488315-488337 AGGTGCCAGCACAGCCCCCGGGG + Intronic
1077061363 11:619160-619182 AGATGTCCCCCCATCCCCAGAGG - Exonic
1077136212 11:1000470-1000492 GGCTGCCCCCCCTGCCCCCGCGG + Exonic
1077358183 11:2128195-2128217 GGCTGTCACCCAAGCCTCTGAGG - Intergenic
1077390253 11:2297477-2297499 ATCTATCACCTCTGCCCCCGAGG + Exonic
1078987618 11:16610721-16610743 AGATGGCACCCCCGCCCCCAGGG - Intronic
1079127799 11:17731207-17731229 AGATGGCACCCCAGCCCACCAGG + Intergenic
1083272790 11:61580644-61580666 AGGGGTCATCCCAGCCCCGGGGG - Intronic
1083853058 11:65378989-65379011 AGCTGTGAGCCCAGCCCCTCTGG - Intronic
1084574699 11:69981633-69981655 TGCTGTCAGCCCAGCCTCCGAGG - Intergenic
1084769337 11:71332401-71332423 AGCTGTAGCCCCAGCCACAGCGG + Intergenic
1084973029 11:72781688-72781710 CGCTGGCACCCCGGCCCCGGCGG - Intronic
1089173027 11:116528395-116528417 AGCTGGCACCACAGCCACAGAGG + Intergenic
1091222162 11:133936001-133936023 GGTTGCCACCCCAGCCCCCACGG - Intronic
1092069751 12:5623042-5623064 AGATGTCACCCCACCCCACCTGG - Intronic
1092451760 12:8608478-8608500 AGCTGTCGCCTCAGCCTCCCGGG - Intronic
1095851144 12:46808217-46808239 AGCTTTCAGCCCAGGCCCCTGGG + Intronic
1096588840 12:52643949-52643971 CTCTCTCACCGCAGCCCCCGGGG - Intergenic
1097014355 12:55974522-55974544 ACCTGTCGCCCGAGCCCCGGGGG + Intronic
1097083170 12:56448279-56448301 AGCTGTAATCCCAGCTCCTGGGG + Intronic
1097280885 12:57845196-57845218 AGCTCCCGCCCCAGCCTCCGGGG + Intronic
1097289726 12:57904593-57904615 TGCTGTCACCCAAGCCCTTGTGG - Intergenic
1097446547 12:59678906-59678928 ACCTGTCACCTCAGCCCCTCTGG - Intronic
1097716540 12:62972237-62972259 AGCTGACACCCCAGCCATTGGGG - Intergenic
1101906067 12:108827453-108827475 AGTTGGCTCCCCAGCCCTCGTGG - Intronic
1101906542 12:108830902-108830924 AGCTGTCACCCCAGCACTTTGGG - Intronic
1102576776 12:113860693-113860715 GGCAGTCACCCCAGCCTCCAGGG - Intronic
1102613228 12:114130845-114130867 GGCTCTCACCCCAGCCTCCTTGG + Intergenic
1102787874 12:115619141-115619163 ACCTCTCAGCCCAGCCCCGGGGG - Intergenic
1103334382 12:120178288-120178310 AGCTATGACCCCTGCCCCCATGG - Intronic
1105011093 12:132757421-132757443 ACCTGTCACCCCAGCGCTTGGGG + Intronic
1108416229 13:50200572-50200594 AGAGGTCACCCCATCCCCCAAGG - Intronic
1112457514 13:99575756-99575778 ACCTGGCACCCCAGCGCCCAGGG + Intergenic
1113721713 13:112562431-112562453 AGCTGTGACCACAGCTCCTGAGG - Intronic
1113833141 13:113312651-113312673 GGCTGTCACCACGGCCCCCGGGG - Intronic
1117630256 14:57683860-57683882 AGCTCCCACCCCAACCCCAGAGG - Intronic
1118796700 14:69151750-69151772 AGCTGTCGCCGCGGCCCGCGGGG + Intronic
1121029971 14:90649902-90649924 AGCTCCCACCCCCGCCCCAGAGG + Intronic
1121416056 14:93779977-93779999 AGATGCCACCCCACCCCTCGTGG + Intronic
1122577464 14:102751199-102751221 ACCTGTCACATCAGCCACCGAGG - Intergenic
1122792733 14:104191214-104191236 ACCTGTGACCTCAGCCCCCTGGG + Intergenic
1122854761 14:104554759-104554781 AGCTGTCACCCCAGCCCCCGCGG + Intronic
1122956727 14:105074720-105074742 GGCTGTCCCCCCAACCCCTGTGG + Intergenic
1123098420 14:105777190-105777212 TGCAGTCTCCCCAGCCCCCTGGG - Intergenic
1124496516 15:30190955-30190977 AGCTGTGAACCCAGCGCCCCGGG - Intergenic
1124747059 15:32347693-32347715 AGCTGTGAACCCAGCGCCCCGGG + Intergenic
1126883862 15:53128901-53128923 AGCTCTCACCCCAGCTGCGGTGG + Intergenic
1128205235 15:65845581-65845603 ACCTGTAATCCCAGCCACCGGGG - Intronic
1128326528 15:66727445-66727467 AGCTCTGACCCCAGCCTCCCTGG - Intronic
1129324138 15:74790612-74790634 AGCTGTCACCCCATTCCCGCAGG - Intronic
1129604127 15:77016503-77016525 AGCTGTCCCCCCAGCCTCAGAGG - Intronic
1130384660 15:83400709-83400731 AGATGTCATCCCTGCCCCCAAGG + Intergenic
1130423426 15:83771926-83771948 AGCTGTCACCTCTGCCTCCCGGG + Intronic
1132675072 16:1118136-1118158 CCCTGTAGCCCCAGCCCCCGGGG - Intergenic
1132977930 16:2719827-2719849 AGCTGGCACACCAGTGCCCGCGG + Intronic
1134070416 16:11256577-11256599 AGCTGTCTCCACACCCGCCGGGG + Intronic
1134601078 16:15534214-15534236 AACTGTCCCTCCAGCCCCAGAGG + Intronic
1136598123 16:31265797-31265819 ATCTGTCCCCGCAGTCCCCGTGG + Exonic
1136775211 16:32868167-32868189 GGCTGTCACCCCAGTACCCAGGG - Intergenic
1136895406 16:33993345-33993367 GGCTGTCACCCCAGTACCCAGGG + Intergenic
1137533475 16:49299445-49299467 AGCTGCCACCCCAGCCCAAATGG + Intergenic
1138386629 16:56639760-56639782 AGCTCTGTCCCCAGCCCCAGAGG - Intronic
1139948950 16:70660090-70660112 AGCTGTACCCTCCGCCCCCGTGG + Exonic
1141801677 16:86313989-86314011 ATCTGTAATCCCAACCCCCGGGG - Intergenic
1142064056 16:88050279-88050301 AGCTGTGGTCCCAGCCACCGGGG - Intronic
1142399930 16:89853260-89853282 AGCTGTAACCCCAGCACTCTGGG - Intronic
1203077628 16_KI270728v1_random:1130276-1130298 GGCTGTCACCCCAGTACCCAGGG - Intergenic
1143588731 17:7866817-7866839 AGCTGTGGCCCCTGCCCCCATGG - Intronic
1144788409 17:17844382-17844404 TGCTGTCACTCCAGCCCCTGGGG - Intronic
1144836942 17:18161490-18161512 AGCTGTCCACCCAGTCCCCAAGG - Intronic
1146223177 17:31043734-31043756 AGCTGTAACCCCAGCACCTCGGG - Intergenic
1146677331 17:34782451-34782473 TGCTGACAACCCAGCCCCCAGGG + Intergenic
1146683728 17:34826560-34826582 AGCTGTCAGCTGGGCCCCCGGGG - Intergenic
1146770202 17:35561949-35561971 ACCTGTCATCCCAGCTCCTGGGG + Intergenic
1148171998 17:45529253-45529275 TGCTGTCACCTCAGCCTCCTGGG - Intergenic
1148277289 17:46316541-46316563 TGCTGTCACCTCAGCCTCCTGGG + Intronic
1148299405 17:46534119-46534141 TGCTGTCACCTCAGCCTCCTGGG + Intronic
1148364020 17:47039311-47039333 TGCTGTCACCTCAGCCTCCTGGG + Intronic
1149249227 17:54749212-54749234 AGGTATCACCCCAGCCACAGTGG - Intergenic
1149568110 17:57653496-57653518 AGCTGTGCACCCCGCCCCCGGGG - Intronic
1149593630 17:57850112-57850134 GGCTTTCACCGCAGCCCCTGCGG + Intergenic
1150135249 17:62691870-62691892 AGGTCTCAGCCCAGCCCTCGTGG - Intronic
1151559216 17:74861723-74861745 AGCTCTCACCGCCGCCCGCGAGG + Intergenic
1152174061 17:78775083-78775105 TGCAGTCACCCCAGCTCCCGAGG + Intronic
1152310017 17:79544417-79544439 AGCTGTCTCCCCAGTCGCTGGGG + Intergenic
1152600623 17:81260410-81260432 AGCTGTGACTCCCGCCCCTGGGG - Intronic
1154411581 18:14144831-14144853 AGCTGGCACCTCAGCTCCAGAGG - Intergenic
1156099594 18:33578261-33578283 AGCTGTCACCGCAGCGGCCGCGG + Intergenic
1159819262 18:73119282-73119304 AGCTGTAATCCCAGCACCCTGGG - Intergenic
1160321995 18:77905256-77905278 GGCTCTCACACCGGCCCCCGAGG + Intergenic
1161026178 19:2038441-2038463 AGCAGGCTCCGCAGCCCCCGGGG + Exonic
1161282550 19:3453815-3453837 TGCTGGCACCTCCGCCCCCGGGG + Exonic
1161317649 19:3625604-3625626 ACCTGTAACCCCAGCTACCGGGG + Intronic
1162381871 19:10335936-10335958 AGCTGGCACCCCTGCCTCCTTGG - Exonic
1162957611 19:14107815-14107837 ACCTGCTACCCGAGCCCCCGAGG - Intronic
1163278908 19:16303118-16303140 ACCTGTCATCCCAGCCACTGGGG + Intergenic
1163666486 19:18606268-18606290 CGCGATCCCCCCAGCCCCCGGGG + Intronic
1163821647 19:19499580-19499602 AGCTGTGCCCCCAGCACCTGGGG + Intronic
1164972791 19:32546800-32546822 AGCTGTAATCCCAGCACCCTGGG - Intergenic
1165385974 19:35510882-35510904 AGCTGCCACCCCAGGGCCCCGGG - Intronic
1165423253 19:35732597-35732619 AGCTGTCCCCCGGGCCCCCGTGG - Exonic
1165761622 19:38324849-38324871 ACCTGTAACCCCAGCCCTCTAGG - Intronic
1167086998 19:47317115-47317137 CACTGTCACCCCAGCCCCTCTGG - Intronic
1167260714 19:48456200-48456222 ACCTGCCCCCCCAGCCCACGGGG + Exonic
1167442352 19:49515684-49515706 ACCTGTCATCCCAGCACCCTGGG - Intronic
1168307769 19:55444719-55444741 GGCAGTCACCCCAGACCCCTGGG - Intergenic
1168688737 19:58364075-58364097 AGCTCTCACCTCAGCCCAGGTGG + Intergenic
925342633 2:3147791-3147813 GGCTGTCACCCCAGCGTCCCCGG + Intergenic
926131191 2:10303871-10303893 ACCTGTCACCACAGCCCCCAAGG - Intronic
927515916 2:23671676-23671698 AGCTGTCCACCCAGCTCCCTAGG + Intronic
927713493 2:25339860-25339882 AGCTGTCACATCTGCCCGCGAGG + Intronic
929453262 2:42050003-42050025 AGATGGCACCCCAGCCCTGGAGG + Intronic
929604947 2:43227519-43227541 AGCTGCACCCCCAGCCCCAGAGG - Intergenic
929941572 2:46337907-46337929 AGCTGGCACACCAGCCCCCTTGG - Intronic
930022178 2:47008105-47008127 AGCTGTCTCCCCAGGCTCCATGG - Intronic
931712615 2:65002153-65002175 ACCTGTAACCCCAGCCACCCAGG + Intronic
932435905 2:71702461-71702483 AGCTGCCTCCCCAGCCACAGGGG + Intergenic
934645070 2:96054520-96054542 AGCTGTGACCTCAGCCACGGTGG + Intergenic
934838477 2:97610609-97610631 AGCTGTGACCTCAGCCACGGTGG + Intergenic
936064054 2:109317345-109317367 AGGTGCCGCCCCAGCCCCAGGGG + Intronic
938116869 2:128608273-128608295 AGCAGTCATCCCTGGCCCCGAGG + Intergenic
938566571 2:132524124-132524146 AGCTGTCACCTCAGTCACAGTGG + Intronic
938651708 2:133390152-133390174 AGCTGTGACCCCAACCCTCCAGG + Intronic
940673071 2:156694889-156694911 AGCTTTCAGCCCAGCACCCATGG + Intergenic
940862247 2:158782949-158782971 AGCCGAGACCCCAGCCACCGAGG + Intergenic
943026923 2:182640893-182640915 AGCTGTAATCCCAGCCACCTGGG + Intergenic
944207318 2:197170080-197170102 ACCTCTCACCTCAGCCCCCCAGG - Intronic
946193599 2:218020651-218020673 AGCTGTCATCCCTGACCCTGGGG + Intergenic
947597990 2:231426047-231426069 AGCTGTCAGAGCAACCCCCGGGG + Intergenic
948048470 2:234961529-234961551 ACCTGTAATCCCAGCACCCGGGG - Intronic
948534035 2:238632843-238632865 AGCTGTCCACCCAGACGCCGGGG + Intergenic
1169894016 20:10483193-10483215 AACTGCAACCCCAGCCCCCTGGG + Intronic
1170623711 20:18014823-18014845 ACCTGTCACCCCAGCCCTTTGGG + Intronic
1172623602 20:36335065-36335087 AGCTGGCACCTGAGCCCCTGGGG + Intronic
1172897678 20:38312020-38312042 TGCTGTCACTCCAGACCCCTTGG + Intronic
1175691221 20:61067287-61067309 AGCTGTCACCCCAGCAGCGTTGG - Intergenic
1176389816 21:6157658-6157680 AGCTGTCACCTCACACCCCAGGG - Intergenic
1176861473 21:14013593-14013615 AGCTGGCACCTCAGCTCCAGAGG + Intergenic
1177861257 21:26457305-26457327 CGCTGTCACCCCAGGCCAAGGGG - Intergenic
1179407367 21:41136827-41136849 AACTGGCAGCCCAGCCCCCCAGG - Intergenic
1179616560 21:42586948-42586970 AGGAGTCACCCCAGCCTCCTGGG + Intergenic
1179618927 21:42599705-42599727 AGCAGTCCCCACAGCCCCAGTGG - Intergenic
1179733651 21:43380580-43380602 AGCTGTCACCTCACACCCCAGGG + Intergenic
1179881332 21:44294431-44294453 AGACGTGACCCCAGCCCCTGTGG + Exonic
1180027780 21:45178201-45178223 AGATGTCACCCCTGCCTCCCTGG + Intronic
1180737630 22:18030065-18030087 AGCTCTCACCTCAGCTCCCTGGG + Intergenic
1181453089 22:23037076-23037098 ACCTGTTACCCCAGCCTCAGTGG - Intergenic
1181909758 22:26229254-26229276 ACCTGTAATCCCAGCACCCGGGG - Intronic
1182077477 22:27504814-27504836 AGCTGTCACCTCGACCCCCCTGG + Intergenic
1182269451 22:29144410-29144432 GACTGCCACCCCAGGCCCCGTGG + Intronic
1182477142 22:30582434-30582456 AGCTGTCATCCCAGCAGCAGGGG + Intronic
1183227977 22:36563363-36563385 AGATGCCACCCCCCCCCCCGGGG - Intergenic
1183233250 22:36596333-36596355 GGCTGGAACCCCAGCCCCCTGGG + Intronic
1183348815 22:37323106-37323128 AGGCTTCATCCCAGCCCCCGTGG - Intergenic
1183653673 22:39173122-39173144 AGCTGACACCCTAGGCACCGGGG - Intergenic
1185366622 22:50439792-50439814 AGCTGGCACCTCAGCTCCAGAGG + Exonic
950158398 3:10741019-10741041 AGCTGTGACCCCAGTCCCTGGGG + Intergenic
953019371 3:39104050-39104072 AGCTTGCACCCCAGCCTCTGGGG + Intronic
959670979 3:108977502-108977524 AGCTATCACACCAGGCACCGTGG - Intronic
961048488 3:123726136-123726158 TGCAGTCACCCCAGCCTCCCAGG + Intronic
961446457 3:126983681-126983703 AACTTTCTCCCCAGCCTCCGTGG - Intergenic
961462594 3:127061967-127061989 AGATGCCACCCCAACCCCAGCGG - Intergenic
961639204 3:128354344-128354366 AACTGCCACTCCAGCCCCAGAGG + Intronic
963921430 3:150909651-150909673 AGCTCACACCCCAGCCTGCGGGG + Intronic
964786280 3:160399882-160399904 TGCTGTCACCCCTCCCCCCTCGG + Intronic
967028423 3:185584347-185584369 GGATATGACCCCAGCCCCCGAGG + Intronic
967979783 3:195058870-195058892 CGCTGACACGCCAGGCCCCGGGG + Intergenic
969045124 4:4331039-4331061 GGCTGTCATCTCAGCACCCGTGG + Intergenic
969051932 4:4379379-4379401 ATCTGTCACCCAAGCCTCGGTGG + Intronic
969080016 4:4610919-4610941 AGTTGTGCTCCCAGCCCCCGGGG - Intergenic
969247970 4:5947875-5947897 AGCTGTCAGCCCAGCCCCCAGGG + Intronic
969606105 4:8203001-8203023 AGCCATCACCCCTGCCCCCATGG - Intronic
970021067 4:11568924-11568946 AGCTGACACCCTAGCCTCTGAGG - Intergenic
970333725 4:15009866-15009888 AGCTTTCACACCAGCCTCCGGGG + Intronic
974229550 4:59091935-59091957 ACCTGGCAGCCCAGCCCCCAGGG - Intergenic
980253627 4:130349391-130349413 AACTGGCAACCCAGCCCCCAAGG + Intergenic
982466975 4:155743665-155743687 AGCGGCCTCCCCAGCCCCAGTGG - Intergenic
983187944 4:164722158-164722180 AGCTGTGACACCAGCTCCCAAGG - Intergenic
985529916 5:427977-427999 AGCAGACACCGCAGCCACCGCGG + Exonic
985959281 5:3287562-3287584 AGCTGTGACCCCAGCTCTCAGGG - Intergenic
986325245 5:6667892-6667914 AGCTGTCTTTTCAGCCCCCGGGG - Intronic
989217786 5:38922898-38922920 ACCTGTAACCCCAGCTACCGGGG - Intronic
990499683 5:56383895-56383917 AGCTAGCACCCCCACCCCCGCGG + Intergenic
990661157 5:58016757-58016779 AGCTCTCCCCCCAGCCCACTTGG - Intergenic
993716282 5:91278604-91278626 ACCTGTAGCCCCAGCCCCTGGGG + Intergenic
995912368 5:117203140-117203162 ATCTGTAACCCCAGCACCCTGGG + Intergenic
997946845 5:138210264-138210286 ACCTGTAACCCCAGCACCCTGGG + Intronic
999251545 5:150185344-150185366 AGCTGGCACCAGAGCCCCCGGGG - Intergenic
1001382347 5:171312764-171312786 TGACGTCACCGCAGCCCCCGCGG + Intergenic
1001692523 5:173643705-173643727 GGATGTAACCCCAGCCCCAGAGG - Intergenic
1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG + Exonic
1002523540 5:179803972-179803994 AGCTGCCTCCCCAGCTCCCGAGG - Intronic
1003031655 6:2606365-2606387 AGCTGTCACCCTTGCCACCTTGG + Intergenic
1006624466 6:35387484-35387506 ATCTCCCACCCCAGCCCCAGGGG + Intronic
1006846920 6:37068864-37068886 AGCTGTGCCCACAGCCCCCACGG + Intergenic
1006852604 6:37109810-37109832 AGCTGCCTCCTCAGCCCCCTTGG - Intergenic
1006944881 6:37778538-37778560 TCCTGTCACCCCATCCCCTGGGG + Intergenic
1006983459 6:38163136-38163158 ACCTGTCACCACAGCCCTCTTGG - Intergenic
1007085422 6:39141015-39141037 AGCTGTTACCCAAGCCCTCCGGG - Intergenic
1009656822 6:66558241-66558263 TGCTGCCACCCCAGCCCCACAGG - Intergenic
1013311819 6:108901538-108901560 ACCTGTCATCCCAGCCACTGAGG - Intronic
1014754513 6:125288365-125288387 GGCTGTGACCCCAGTCCCCACGG + Intronic
1016807717 6:148229007-148229029 ACCTGTCACCCCAGCTACTGGGG + Intergenic
1019286951 7:228439-228461 AGCCGTGACACCAGCCCCCTGGG - Exonic
1019300880 7:302866-302888 ACCTGTCATCCCAGCTTCCGGGG - Intergenic
1019312437 7:369347-369369 TGCTGACAGCCCAGCCCCCCAGG + Intergenic
1020137659 7:5595728-5595750 AGCTCTCACCCAAGGTCCCGTGG - Intronic
1020313325 7:6886307-6886329 ACCTGTAACCCCAGCACCTGGGG - Intergenic
1021632610 7:22661768-22661790 AGCTGCCACCCCAGCCACCTGGG + Intergenic
1021890859 7:25185003-25185025 CTCTGTAACCCCAGCCACCGGGG + Intergenic
1024561065 7:50645805-50645827 AACTGTCACCAGAGCCCCAGTGG + Intronic
1026900126 7:74032428-74032450 AGCTGCTTCCCCAGGCCCCGTGG - Intronic
1031994770 7:128222719-128222741 AGCTTTCACGCCACCCCCCAGGG + Intergenic
1033243859 7:139702524-139702546 AGGTCTCCCCCCAGCCCCCAGGG - Intronic
1034343281 7:150371315-150371337 AGGAGTCACCCCAGACCCTGGGG + Exonic
1035478929 7:159165991-159166013 AGTCATCACCCCAGCCCCAGAGG - Intergenic
1038174856 8:25171560-25171582 AGCTGACAGCCCTGCCCCTGTGG - Intergenic
1038613269 8:29072181-29072203 AGCGGTCACCCCGGCTCCGGAGG - Exonic
1039936469 8:42051255-42051277 GGCTGTCAGCCCAGCCGCCGAGG - Intronic
1041090892 8:54299975-54299997 GGCTGACAGCCCACCCCCCGCGG - Intergenic
1041176881 8:55206212-55206234 AGCTGGCCACCCAGCCCCAGTGG - Intronic
1043455015 8:80404163-80404185 ACCTGTAATCCCAGCCACCGGGG + Intergenic
1043472916 8:80578995-80579017 AGCTGTCACCCCGGCCCCAGGGG - Intergenic
1047382127 8:124373047-124373069 CGCTGCCACCCCAGCCCCGACGG + Intergenic
1049060243 8:140270888-140270910 TGCTGTCGCCCTGGCCCCCGCGG - Intronic
1049298121 8:141854719-141854741 AGGTGTCACACCAGTGCCCGTGG + Intergenic
1049535360 8:143177983-143178005 AGCTGGCCCTCCTGCCCCCGCGG + Intergenic
1049840121 8:144765696-144765718 AGCTCCCACCCCAGCTCACGGGG - Intergenic
1050990748 9:12149036-12149058 AGCACTCACCTCAGCCCCTGCGG - Intergenic
1053280886 9:36819214-36819236 AGCTGTCAGCCCCGCTCCCCCGG - Intergenic
1053610403 9:39707680-39707702 AGATGTCTCCCCAGCCCCAGGGG + Intergenic
1053868441 9:42465710-42465732 AGATGTCTCCCCAGCCCCAGGGG + Intergenic
1054087848 9:60763476-60763498 AGATGTCTCCCCAGCCCCAGGGG - Intergenic
1054243119 9:62634715-62634737 AGATGTCTCCCCAGCCCCAGGGG - Intergenic
1054557244 9:66669233-66669255 AGATGTCTCCCCAGCCCCAGGGG - Intergenic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1058984593 9:110199039-110199061 ACCTGTAACCCCAGCTACCGGGG + Intronic
1059681533 9:116590625-116590647 ATCTGGCAGCCCAGCCCCCAGGG - Intronic
1060103941 9:120862078-120862100 TGCTGTGACCCCCGCCCCTGCGG - Intronic
1060106588 9:120876867-120876889 ACCTGTCACCCATGCCCCCCGGG + Intronic
1060200891 9:121651417-121651439 GGCTCCCACCCCCGCCCCCGAGG - Intronic
1060853144 9:126894252-126894274 AGCTGACAGCCCAGCCCTCATGG + Intergenic
1061107004 9:128538669-128538691 ACCTGTCATCCCAGCTACCGAGG + Intronic
1061420963 9:130472633-130472655 AGCTGCCACCCTTGCCCCCTGGG + Intronic
1062095709 9:134702077-134702099 GGCTGTCGCCCCAGCACCCCAGG - Intronic
1062277213 9:135736695-135736717 AGCCGGCGCCGCAGCCCCCGAGG + Intronic
1062309418 9:135928129-135928151 AGCTGCCACCCCTGCCCTCTGGG + Intergenic
1062332241 9:136049889-136049911 CGCCGCCACCGCAGCCCCCGCGG + Exonic
1062415889 9:136449593-136449615 ACCTGTCACCCCAGCACTCTGGG - Intronic
1185503285 X:614952-614974 ACCTGTCATCCCAGCTACCGGGG + Intergenic
1185503456 X:615991-616013 ACCTGTCATCCCAGCTACCGGGG + Intergenic
1186342681 X:8660513-8660535 ATCTGTCATCCCAGCCCTCTAGG + Intronic
1186509021 X:10116913-10116935 TGTTCTCACCCCAGCCCCAGTGG + Intronic
1187061323 X:15789962-15789984 AGCTGTTACCTCTGCCCCTGAGG - Intergenic
1190426359 X:50337354-50337376 GGCTGTCACTCCACCCACCGAGG - Intronic
1200062929 X:153491612-153491634 AGCTGCCACCCCAGCCTGCCTGG - Intronic
1200086993 X:153611801-153611823 AGCTCTCCCCACAGCCTCCGGGG + Intergenic
1200093810 X:153647994-153648016 AGCTGTCGCCCCCGCGGCCGCGG + Exonic
1200104712 X:153705893-153705915 GGCTGTCACCCCAGTACCCAGGG + Intronic
1200148414 X:153939524-153939546 AGCTGTCATCCCAGCCAGTGAGG - Intronic
1201400314 Y:13597609-13597631 AGCAGCCTCCCCAGCCCCAGTGG - Intergenic