ID: 1122858094

View in Genome Browser
Species Human (GRCh38)
Location 14:104569591-104569613
Sequence ATTCCCTGCCTGGCAGACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122858094_1122858100 27 Left 1122858094 14:104569591-104569613 CCGGTGTCTGCCAGGCAGGGAAT 0: 1
1: 0
2: 2
3: 17
4: 228
Right 1122858100 14:104569641-104569663 AGCACTTGGCTTTCGTTTAGTGG 0: 1
1: 0
2: 0
3: 9
4: 89
1122858094_1122858097 -10 Left 1122858094 14:104569591-104569613 CCGGTGTCTGCCAGGCAGGGAAT 0: 1
1: 0
2: 2
3: 17
4: 228
Right 1122858097 14:104569604-104569626 GGCAGGGAATCCTTTATAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1122858094_1122858099 13 Left 1122858094 14:104569591-104569613 CCGGTGTCTGCCAGGCAGGGAAT 0: 1
1: 0
2: 2
3: 17
4: 228
Right 1122858099 14:104569627-104569649 CTCTGCACACACACAGCACTTGG 0: 1
1: 0
2: 4
3: 38
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122858094 Original CRISPR ATTCCCTGCCTGGCAGACAC CGG (reversed) Intronic
900173823 1:1283320-1283342 CTTCCCTGGCTGACAGACACTGG - Intronic
900523877 1:3119173-3119195 AGCCCCTGCCTGGCAGAGCCTGG + Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
902580270 1:17403630-17403652 ATTGCCTGCATAGCAGACACGGG + Intergenic
904307298 1:29598570-29598592 ATTATCTGGCCGGCAGACACTGG - Intergenic
904326679 1:29731127-29731149 ATCCCTTCCCTGGCAGAGACAGG + Intergenic
904675054 1:32193965-32193987 ATTCCCCACCTTGGAGACACAGG + Intronic
904743424 1:32695904-32695926 ATTCTCTACCTGGAGGACACAGG - Exonic
904909324 1:33922179-33922201 ATTCCCTGCCTCACAGTCTCTGG - Intronic
905302978 1:36998139-36998161 AGTCTCTGACTGGAAGACACTGG + Intronic
905470149 1:38185721-38185743 AGTGCCTCCCTGGCAGACACTGG + Intergenic
906509430 1:46402354-46402376 CTTCCCTCCCTGGCAGTCCCTGG - Intronic
907875822 1:58486943-58486965 ATTACGTGCCTGGAAGACATAGG + Intronic
908551400 1:65212328-65212350 AATTCCAGCCTGGGAGACACAGG - Intronic
909562120 1:77018633-77018655 ATTCACTGTGTGGCAGACGCAGG - Intronic
910136946 1:83983531-83983553 ATACCCTTCCTAGCAAACACTGG + Intronic
910436193 1:87208564-87208586 ATACAGTGCCTGGCACACACCGG + Intergenic
911681379 1:100719781-100719803 ATACCCTCCCAGGCACACACAGG + Exonic
912491636 1:110065731-110065753 CTTCCCTGCCTGTTAAACACAGG - Intronic
912498528 1:110106725-110106747 ACTCCCTGCCTGTCATCCACTGG - Intergenic
912698915 1:111861668-111861690 ATTCCCAGCCTGGCAGAGCAGGG + Intronic
914991504 1:152502984-152503006 ATACTCCGCCTGTCAGACACGGG + Intergenic
915952709 1:160200184-160200206 ATTCCCTCCCTGGCACTCCCAGG + Intronic
917419688 1:174849924-174849946 TTTACCTGCATGGAAGACACAGG + Intronic
918854639 1:189735466-189735488 ATTCTCTGACTGACATACACTGG + Intergenic
919027750 1:192200079-192200101 ATTCCCTTCCTGGAACACACAGG + Intergenic
919081883 1:192876991-192877013 ATATCCTGCCTGGCAGTGACTGG - Intergenic
920725178 1:208428284-208428306 ATGCCCAGCTTGGCAGACACTGG - Intergenic
1063502069 10:6564094-6564116 GTGCCCTGCCTGCCAGACTCAGG - Intronic
1063566594 10:7176828-7176850 ACCCCCAGCCTTGCAGACACTGG + Intronic
1067230357 10:44403011-44403033 ACTCCCTGCCTGCCACACACTGG - Intergenic
1068695666 10:59965730-59965752 ATTTCCTCACTGGCACACACAGG + Intergenic
1071506070 10:86232324-86232346 GTTCTCTGGCTGGCAGTCACTGG + Intronic
1073447905 10:103592081-103592103 ATGCCCTGCCTGCCACACAGAGG - Exonic
1073889587 10:108084021-108084043 ATACAGTGCGTGGCAGACACAGG + Intergenic
1073953206 10:108835314-108835336 ATCCACTGCCTGGTGGACACTGG - Intergenic
1075317299 10:121463101-121463123 GATCCTTGCCTGGCAGTCACAGG - Intergenic
1076098212 10:127750911-127750933 ATTCCCTGCTTGGCCAACAAAGG - Intergenic
1077035336 11:491682-491704 TGTCCCAGGCTGGCAGACACTGG + Intergenic
1077035348 11:491738-491760 TGTCCCAGGCTGGCAGACACTGG + Intergenic
1077035360 11:491794-491816 TGTCCCAGGCTGGCAGACACTGG + Intergenic
1077035372 11:491850-491872 TGTCCCAGGCTGGCAGACACTGG + Intergenic
1077035384 11:491906-491928 TGTCCCAGGCTGGCAGACACTGG + Intergenic
1078325408 11:10376617-10376639 ACTCACTGCCTGCCAGGCACAGG - Intronic
1080145331 11:28976294-28976316 CTTCTCTCCCTGGCAGAAACAGG + Intergenic
1080703593 11:34667223-34667245 AATCTCTGCCTGGCTGAAACCGG + Intergenic
1082826264 11:57581765-57581787 ATCCCGTACTTGGCAGACACAGG - Intergenic
1084301410 11:68254926-68254948 ATTGGATGCCAGGCAGACACTGG - Intergenic
1084463066 11:69306981-69307003 ATCCCCTGCATGGCAACCACTGG - Intronic
1085267953 11:75248539-75248561 ATTCCCAGCCTGGGTGACAGAGG - Intergenic
1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG + Intronic
1087806646 11:102562616-102562638 ATTGCTTGCCTGGGAGACAGAGG + Intergenic
1089144690 11:116317175-116317197 ACTCCCTGCCTTGCATGCACAGG - Intergenic
1093386994 12:18569225-18569247 TTTCTCTGCCGGGCAGACTCAGG - Intronic
1096491131 12:52013669-52013691 GTCCCCTGCCAGGCAGACAAGGG - Exonic
1103794560 12:123494433-123494455 CTTCCCTGTCTGGCAGCCAATGG - Intronic
1104390653 12:128388302-128388324 ATTCGCTGCCTGGCAGCCATCGG - Intronic
1104814541 12:131638155-131638177 ATCCCCAGCCTGGCACCCACTGG - Intergenic
1104858413 12:131912627-131912649 ATTGTGTCCCTGGCAGACACGGG - Intronic
1105769285 13:23593425-23593447 ACTCCATGCCTGGCCCACACTGG - Exonic
1107566188 13:41607194-41607216 AATACCTGCCTGGCACACAGTGG + Intronic
1109453385 13:62549073-62549095 ATTCCCTGCCAAGGAAACACTGG + Intergenic
1115235618 14:31207015-31207037 CTTCCCTTCCTCGTAGACACAGG - Exonic
1116144475 14:41046464-41046486 CTTCCATGAGTGGCAGACACTGG - Intergenic
1117113396 14:52483448-52483470 ATTCTCTACCTGGCAGACTTTGG - Intronic
1118288722 14:64501933-64501955 ATTCCCTTCCCGGCTGAAACAGG + Intronic
1119616199 14:76100645-76100667 CTTCCCTCCCTGGCAGACCCAGG - Intergenic
1120861775 14:89261231-89261253 ATTCCCTGTATGGCAGGCATGGG + Intronic
1121909032 14:97772205-97772227 AATCCCAGCCTGGCAGCCATTGG - Intergenic
1122660794 14:103293643-103293665 ATCCCCTGGCAGCCAGACACAGG - Intergenic
1122710361 14:103652390-103652412 ATTCCCAGCCTGGCACACCATGG + Intronic
1122816419 14:104316306-104316328 AGTCCCAGCCTGGCTGTCACAGG + Intergenic
1122858094 14:104569591-104569613 ATTCCCTGCCTGGCAGACACCGG - Intronic
1122959270 14:105087211-105087233 TTTCCCTGCCTGGGAAACAAAGG - Intergenic
1123538355 15:21261674-21261696 ACTCCCTGCCTGGTAGTCCCAGG + Intergenic
1123699676 15:22904899-22904921 AGACCTTGGCTGGCAGACACTGG - Intronic
1125796348 15:42406745-42406767 CATCCCTGCCAGGCACACACTGG - Intronic
1126340356 15:47634728-47634750 ATTCCCTGCCTGACAGACAGAGG - Intronic
1127275391 15:57439002-57439024 ATTCCCTTCCTGCCAGGAACTGG + Exonic
1129824561 15:78626048-78626070 ATTCATTCCCTGGCAGAGACGGG + Intronic
1130275687 15:82475248-82475270 CTTCCCTCCCTGCCAGCCACAGG + Intergenic
1130468046 15:84202640-84202662 CTTCCCTCCCTGCCAGCCACAGG + Intergenic
1130496220 15:84470902-84470924 CTTCCCTCCCTGCCAGCCACAGG - Intergenic
1130590338 15:85207238-85207260 CTTCCCTCCCTGCCAGCCACAGG + Intergenic
1131215469 15:90531619-90531641 TTTACCTGCCTGGCATCCACTGG + Intronic
1133920342 16:10147133-10147155 ATACTATGCCTGGCATACACAGG - Intronic
1134839174 16:17387616-17387638 ATTGGCTGCCTGGCAGGCAAGGG + Intronic
1135131327 16:19855987-19856009 CTTTCCTGTTTGGCAGACACAGG + Intronic
1135734326 16:24918733-24918755 AGTCACTGCCTAGAAGACACTGG - Intergenic
1136140297 16:28283960-28283982 ATACTCTGCCTGTCAGTCACCGG - Intergenic
1136414509 16:30095428-30095450 ACTCCCTCCCCGGCAGGCACTGG - Exonic
1136449620 16:30346401-30346423 ATTACATGCCTGGCAGAGAACGG + Intergenic
1138342689 16:56301019-56301041 ATTCCCTGCTGAGCAGCCACGGG + Intronic
1138785796 16:59844855-59844877 ATTACCTCCCTGGAAGACACAGG - Intergenic
1139973346 16:70790192-70790214 CATCCCTGCCTGGCAGACACGGG - Intronic
1140268539 16:73442041-73442063 ATTGCCTGCCTGCCTGACCCAGG - Intergenic
1142251625 16:88994439-88994461 TTTTCCTGCCTGGGAGACCCTGG - Intergenic
1142285171 16:89168692-89168714 AGGCCCTGCCTGTCAGACAGGGG + Intergenic
1144686883 17:17231976-17231998 ATTCCCTGCCAGCCACACCCAGG - Intronic
1144753059 17:17663321-17663343 ATGCCCAGCCTTGCACACACAGG + Intergenic
1145193384 17:20867085-20867107 ACTCCCTGCCTGGTAGTCCCAGG + Intronic
1145768271 17:27474296-27474318 ATTGCCTGGCTTGCAGCCACAGG - Intronic
1146512643 17:33463485-33463507 ATTCACTGACTGACAGACATTGG - Intronic
1148476291 17:47930900-47930922 ATTCCATGCCTGGAAGAAAGAGG + Intergenic
1148573240 17:48687826-48687848 ACTCCCTGCCAGGAAGACTCAGG - Intergenic
1151874033 17:76856450-76856472 TTTCCCTGCCTGTCAGGGACAGG - Intergenic
1155210010 18:23592608-23592630 AATCCCTGACTGGCAGAAACTGG - Intergenic
1155340738 18:24811868-24811890 AGTCCCTGCCTGGCTGTCAAAGG + Intergenic
1155931521 18:31713763-31713785 TTTACCTGCCTGGCTGCCACAGG - Intergenic
1157135247 18:45047894-45047916 ATTCTCTCCCTGGGAGACACTGG + Intronic
1157139494 18:45091325-45091347 ATCCCTTGCTTGGCTGACACTGG - Intergenic
1157327228 18:46678058-46678080 ATTCCCTCCCTGGGAGAAATAGG + Intronic
1158060314 18:53332863-53332885 ATTCCCAGCCTGGGCAACACAGG + Intronic
1160392753 18:78547587-78547609 AATCCCTGCCTGGTAGAGGCTGG - Intergenic
1161377981 19:3950003-3950025 CCTCCCTGCCTGGGAGGCACTGG + Intergenic
1161495654 19:4584473-4584495 CTTCCCTTCCTGGCAGGCGCCGG - Intergenic
1164845007 19:31424567-31424589 TTTCTCTGCCTGGCAGACATAGG - Intergenic
1164870556 19:31639997-31640019 ATTCACTGCCTGGCACCCAATGG - Intergenic
1168311528 19:55463358-55463380 ACTCCCTTCCTGGCAGCCCCTGG - Intergenic
925577263 2:5373325-5373347 CTTTCCTGCCTGTCAGCCACAGG + Intergenic
925636506 2:5946404-5946426 ATCCTCTGCCTGTCACACACAGG + Intergenic
926332980 2:11840368-11840390 ATTGCCTGCCCTCCAGACACTGG - Intergenic
929489328 2:42382552-42382574 AAGGCCTGCCTCGCAGACACTGG + Intronic
929706867 2:44222762-44222784 TTTTCCTGCATGGTAGACACAGG - Intronic
931745411 2:65287671-65287693 GTTCCCTGCGTGTCAGACCCTGG - Intergenic
931768685 2:65479131-65479153 ACTCCATCCCTGGCACACACAGG + Intergenic
932347949 2:71007775-71007797 CTCCTCTGCCTGGCACACACAGG - Intergenic
935922450 2:108031073-108031095 GTTCCCTGGGTGGCAGACATTGG - Intergenic
937292393 2:120789471-120789493 ATTCTCTGACTGGAAGCCACAGG + Intronic
937307334 2:120880467-120880489 CTTCCCCGCCTCGCAGACAAGGG + Intronic
937992651 2:127673091-127673113 CTTCCCTGCCTTCCATACACAGG - Intronic
938398908 2:130971911-130971933 AGTCACTGTCTGGCAGACCCAGG - Intronic
939048283 2:137275960-137275982 ATTCCCTGCCAGACAGACTCTGG - Exonic
941714371 2:168748681-168748703 ATTTCCAGCCTGGCAGTTACAGG + Intronic
946194624 2:218025652-218025674 GATCCCTGCCTGGGAGACAGGGG + Intergenic
946775572 2:223136721-223136743 ATTTCTTGCTTGGCAGAGACTGG - Intronic
947520898 2:230845287-230845309 GTGTCCTGCCTGGCAGCCACAGG - Intergenic
947717564 2:232349572-232349594 CATTCTTGCCTGGCAGACACCGG + Intergenic
1169198831 20:3697780-3697802 ATTCCCTGCCTGACTCACCCTGG + Exonic
1169277565 20:4243962-4243984 AGTCACTGGCTGGGAGACACTGG - Intronic
1169854396 20:10087763-10087785 ATTTAGTGCCTGGCATACACTGG - Intergenic
1170711450 20:18794788-18794810 CTTGCCTCCCTGACAGACACTGG + Intergenic
1171300203 20:24053129-24053151 ATCCCCTGCAGGTCAGACACTGG - Intergenic
1171561946 20:26134579-26134601 ACTCCCTGCCTGGTAGTCCCAGG + Intergenic
1172124410 20:32616764-32616786 ATTTCCTGCCCAGCAGTCACAGG + Intergenic
1172206580 20:33166947-33166969 CTTCCCTGGCTGCCTGACACCGG - Intronic
1175263390 20:57688598-57688620 GTTCCCTGCCTGGCAGAGTGAGG - Intronic
1181458917 22:23074793-23074815 ATGCCCTGCCTGCTTGACACAGG - Intronic
1182076620 22:27499475-27499497 CTTCCATGCCTGGCACCCACAGG - Intergenic
1184951673 22:47847462-47847484 ATTCCCTGTGTGTCAGACCCGGG + Intergenic
1185032871 22:48453910-48453932 ATTTCCTGCGTGGGAGACATGGG - Intergenic
956131173 3:66055241-66055263 ATTCTCTGCAAGTCAGACACTGG - Intergenic
957163365 3:76638921-76638943 ACTCCCTGCCTGTCAAGCACTGG + Intronic
958632963 3:96704295-96704317 ATGCCCTGCGAGGCAGACAAGGG + Intergenic
961001061 3:123374320-123374342 CTTCCCATCCTGGCAGACAGTGG - Intronic
961424146 3:126831660-126831682 TTTCCCAGCCTGGGGGACACAGG - Intronic
961995853 3:131242024-131242046 AATGCCTGCCTAGCAGCCACAGG - Intronic
968266497 3:197367334-197367356 CTTCTCTGCCTTGTAGACACGGG + Intergenic
968481163 4:833662-833684 AATACCTGGCTGGCAGACAGTGG - Intergenic
970857256 4:20663298-20663320 ATTCCCTTCTTGGGGGACACAGG - Intergenic
975373918 4:73620401-73620423 AGTCCCAGCCCGGCAGAGACAGG - Intronic
975845006 4:78515783-78515805 CTTCCCTCCCTGGCAGAGGCAGG + Intronic
976026851 4:80698360-80698382 ATTCACTGACTGCTAGACACTGG - Intronic
980418603 4:132527359-132527381 AGTCACTTTCTGGCAGACACAGG - Intergenic
982211951 4:153044999-153045021 ATTCCCTACATGGAAGACAAAGG + Intergenic
984935956 4:184889641-184889663 ACTCCCTGGCTGGCACACACGGG - Intergenic
985651641 5:1110404-1110426 ACTTCCTGCTGGGCAGACACAGG + Intronic
986001695 5:3635499-3635521 ATTCGCTGCATTGCAGACAGCGG - Intergenic
987998755 5:25321020-25321042 ATTCCCTGCCTGACTGTTACAGG + Intergenic
991356503 5:65774604-65774626 ACTCCTTGCTAGGCAGACACAGG - Intronic
992139906 5:73785588-73785610 ATTGCCTGCCTGGCATCTACTGG + Intronic
992380228 5:76229186-76229208 ATCCTCAGCCTGGCAGACATAGG - Intronic
995784464 5:115814387-115814409 ATTCACAGCCTGGCCCACACGGG + Intronic
996702108 5:126460672-126460694 GCTCCGTGGCTGGCAGACACAGG - Intronic
997014296 5:129913247-129913269 TTTCCCTGCCTGGCTTACATAGG + Intronic
997408855 5:133674705-133674727 ATACCATGCCTGGCACACAGTGG + Intergenic
999170570 5:149590679-149590701 ATTCTCTGCCTGGGAGGCAGAGG - Intronic
999312255 5:150558989-150559011 ATCACCTGCATTGCAGACACTGG - Intergenic
999366357 5:151026275-151026297 ATGCTCTGCCTGGCAATCACAGG + Intronic
1000139745 5:158390606-158390628 ATACCATGCCTGGCCTACACTGG + Intergenic
1000981264 5:167819549-167819571 AGTCCCTGCTTGGCAGGCAGAGG - Intronic
1001117004 5:168948224-168948246 ATGCACTGCCTGGCACACAGTGG + Intronic
1001454317 5:171848894-171848916 CATTCCTGCCTGGCAGAGACCGG - Intergenic
1002137373 5:177116308-177116330 TTTCCCTGCCTGACAAACAAAGG - Intergenic
1002873633 6:1190587-1190609 ATTTCCTGCCTGGCTGAACCAGG + Intergenic
1003052530 6:2792889-2792911 ATTCCCTGCCTGCCATATGCTGG + Intergenic
1004412936 6:15398586-15398608 CTTCCTGGCCTGACAGACACAGG + Intronic
1004500513 6:16205883-16205905 GTTCCCTGAATGGCAGACAATGG + Intergenic
1004720300 6:18263316-18263338 TTTCCCTCCCTGGCAAACAGCGG - Intronic
1005360244 6:25024366-25024388 ATTGCCTACCTGGCCAACACTGG - Intronic
1005609712 6:27512126-27512148 ATTCCCTGCATGAAAGACACTGG - Intergenic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007474211 6:42107972-42107994 CTTTCCTGCCCCGCAGACACAGG + Intronic
1007615728 6:43179010-43179032 CTTCCCTGCCTGCCAACCACAGG - Intronic
1012921139 6:105222059-105222081 ATTCCCTCCCTGACCTACACTGG - Intergenic
1015328498 6:131951058-131951080 AGTCCCTCCCTGGCAGCCGCCGG + Intronic
1019764122 7:2837104-2837126 ATTCTCTGCCTGGAAGAAGCAGG + Intronic
1019831605 7:3336279-3336301 ATATCCTGCCTGGCAGAAGCAGG + Intronic
1020202709 7:6092782-6092804 ATTTCCTTCCTAGGAGACACCGG + Intergenic
1021923838 7:25515410-25515432 GTTCCCTGCTTGGCAGGCTCTGG + Intergenic
1028928677 7:96388842-96388864 CTTCCCTGCCTGGCTGAGTCAGG - Intergenic
1031642410 7:124180974-124180996 ATACCCTAGCAGGCAGACACAGG - Intergenic
1032480158 7:132239614-132239636 ATACCTTGCCAGGCAGACAGGGG - Intronic
1032519093 7:132529169-132529191 AGGCCCTACCTGGCAGCCACTGG + Intronic
1033343078 7:140507028-140507050 GTTAGCTGCCTGGCAGACATGGG + Intergenic
1033964953 7:146963891-146963913 CTTCCCAGGCTGGAAGACACTGG + Intronic
1035105546 7:156439453-156439475 AGTCACTGACTGGCAGACAGTGG + Intergenic
1035379647 7:158429549-158429571 ATTCCCGGCCTGGGAGAGCCTGG + Intronic
1035648369 8:1245936-1245958 CTTCCCTGCTTGTCAGGCACAGG - Intergenic
1037604424 8:20425498-20425520 ATTCCCTGCCTGGCTGCCTGAGG + Intergenic
1038331616 8:26613709-26613731 CTTCCCTGGCTGGCAGGCATGGG - Intronic
1039024551 8:33243524-33243546 ATTCCCAGCCTTGCCTACACAGG + Intergenic
1039259831 8:35759454-35759476 ATTCACTGCCTGCCAGGTACTGG + Exonic
1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG + Intergenic
1039457349 8:37716259-37716281 ATTACCTGCCAGGCACAGACTGG - Intergenic
1039659663 8:39448633-39448655 ATCCCCAGCCTGACAGCCACAGG + Intergenic
1040110648 8:43565857-43565879 AGTGCCTGCCAGGAAGACACTGG + Intergenic
1041901758 8:62989966-62989988 ATTCCCTGCCCTGCACACAAAGG + Intronic
1041961434 8:63621578-63621600 ATTCCTTACCTGGCAGCCAAAGG - Intergenic
1042029322 8:64458006-64458028 ATTCCCTGCCTGACACTCAGTGG + Intergenic
1042116908 8:65442316-65442338 ATTCCAGGCCTAACAGACACTGG + Intergenic
1042200295 8:66274770-66274792 CTCCCCTGCCTGACAGCCACCGG + Intergenic
1043394704 8:79825265-79825287 CTTCCCTACCTGGCAGAAAGGGG + Intergenic
1045477306 8:102564268-102564290 ATTCCCTGCAGGCCAGACTCAGG - Intergenic
1047957075 8:129984314-129984336 CAGCCCTGCCTGGGAGACACTGG - Intronic
1048262556 8:132957330-132957352 TTTCCCAGGCTGGCAGACCCAGG + Intronic
1048316987 8:133369905-133369927 TTTCCATGCCAGGCAGAGACAGG + Intergenic
1048327685 8:133451713-133451735 GTCCCCTGCTTGGCAGACATGGG + Intergenic
1049325762 8:142020686-142020708 AATCACTGCCTGGCAGCCACTGG + Intergenic
1052798478 9:32946089-32946111 ATTGCCTACCTGGCCAACACTGG + Intergenic
1055673677 9:78632980-78633002 ATTGACTCCATGGCAGACACTGG + Intergenic
1055730706 9:79277152-79277174 ATTCCCAGCCTGGGTGACAGAGG - Intergenic
1056386144 9:86099113-86099135 ATTCCCTGCCCTGCAGTCTCAGG - Intronic
1056784167 9:89577057-89577079 CTTCCCTGCCTGCCAGCCCCTGG + Intergenic
1058760325 9:108124488-108124510 ATTTCCTGGCTGGGATACACAGG - Intergenic
1059325263 9:113500461-113500483 ATTTCTTGCCTGGCAGTCCCAGG - Intronic
1060709605 9:125845551-125845573 ATTCCCTGCCTGCCCTACAAGGG + Intronic
1061173517 9:128976987-128977009 ATCACTTGCCTGGGAGACACAGG + Intronic
1061251866 9:129431193-129431215 ATCCCCTGCCTGGCTGGGACAGG - Intergenic
1061839036 9:133347190-133347212 CTTCCCTGCCGCGCAGAGACTGG - Exonic
1185610860 X:1392888-1392910 AGCCCCCGCCGGGCAGACACGGG - Intergenic
1186978559 X:14934405-14934427 ATTCCCAGCGTGGAAGAAACAGG + Intergenic
1190995977 X:55609627-55609649 ATTCCCTGTCTGTCACACAGAGG + Intergenic
1191895387 X:65987184-65987206 ATACTCTGCCTGGCACACAAAGG - Intergenic
1195639128 X:107154829-107154851 ATTCCCTAAGTGGAAGACACAGG + Intronic
1198716013 X:139558393-139558415 ATCCCCTGCCTGCCAGCCACAGG - Intronic
1198754830 X:139971543-139971565 ATTCCATGCCTGGCATACGGTGG - Intergenic
1200125551 X:153812552-153812574 AATACCTGCCTGGCTGTCACAGG - Intronic