ID: 1122859656

View in Genome Browser
Species Human (GRCh38)
Location 14:104576855-104576877
Sequence CTCCTGCTACAGAGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 2, 2: 2, 3: 26, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122859645_1122859656 25 Left 1122859645 14:104576807-104576829 CCCTACGGCAGAGGGAGCTGGGA 0: 1
1: 2
2: 1
3: 12
4: 215
Right 1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG 0: 1
1: 2
2: 2
3: 26
4: 240
1122859649_1122859656 -7 Left 1122859649 14:104576839-104576861 CCTCAGCCCGGCGTTCCTCCTGC 0: 1
1: 0
2: 0
3: 31
4: 477
Right 1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG 0: 1
1: 2
2: 2
3: 26
4: 240
1122859643_1122859656 26 Left 1122859643 14:104576806-104576828 CCCCTACGGCAGAGGGAGCTGGG 0: 1
1: 0
2: 3
3: 16
4: 174
Right 1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG 0: 1
1: 2
2: 2
3: 26
4: 240
1122859641_1122859656 27 Left 1122859641 14:104576805-104576827 CCCCCTACGGCAGAGGGAGCTGG 0: 1
1: 0
2: 1
3: 23
4: 165
Right 1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG 0: 1
1: 2
2: 2
3: 26
4: 240
1122859646_1122859656 24 Left 1122859646 14:104576808-104576830 CCTACGGCAGAGGGAGCTGGGAT 0: 1
1: 0
2: 4
3: 19
4: 232
Right 1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG 0: 1
1: 2
2: 2
3: 26
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122859656 Original CRISPR CTCCTGCTACAGAGGGAGCT GGG Intronic
900095697 1:939280-939302 CTGCTGCTGCCGCGGGAGCTGGG + Exonic
900385486 1:2408704-2408726 CTCCTGCTCCAGGGGGAGCAGGG + Exonic
901614162 1:10524807-10524829 CTCCAGCTACTTGGGGAGCTAGG - Intronic
901807790 1:11749026-11749048 CTCCTGCTGCAGAGACTGCTAGG + Intronic
901827047 1:11868993-11869015 ATCCTGACACAGAGAGAGCTGGG - Intergenic
901861865 1:12079573-12079595 CTCCTTCTCCACCGGGAGCTGGG + Intronic
903071598 1:20729536-20729558 CTGCTGCTCAGGAGGGAGCTTGG + Intronic
903353824 1:22734202-22734224 CTCCTGCTAAAGAGGCAGCCAGG - Intronic
903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG + Intergenic
903966833 1:27095978-27096000 CCCCTGCCAGAGAGGGAGCCGGG - Intergenic
904488426 1:30843202-30843224 CTCCTGGTATATAGGGAGCTTGG + Intergenic
904868336 1:33600497-33600519 CTCCTTCTCCAAAGGGATCTAGG - Intronic
905247741 1:36626662-36626684 TTCCTGCTTCTTAGGGAGCTGGG + Intergenic
905797030 1:40821524-40821546 CTCCTGCTGCAGAGGAAGCTCGG + Intronic
908246098 1:62228691-62228713 CTCCTGTTTCAGTGAGAGCTGGG - Intergenic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
910355870 1:86353886-86353908 CTCCTGCTACAGTGGAATATGGG - Intronic
912339619 1:108899571-108899593 ATCCTGCCACAGAAGAAGCTGGG - Intronic
912828161 1:112925199-112925221 CTCCAGCCACAGAGGGAGACTGG - Intronic
914350532 1:146835973-146835995 CTGCTGCAGGAGAGGGAGCTGGG - Intergenic
915141947 1:153773380-153773402 CTCCTTCCACCGGGGGAGCTTGG - Exonic
916070228 1:161165794-161165816 CACCTGTTAGAGAGGGAACTTGG - Intergenic
920349698 1:205329660-205329682 CTCCTTCTACAGATGGAACAGGG + Intergenic
920506160 1:206516972-206516994 CTTCTGGTACAGAGGTTGCTTGG + Intronic
921218406 1:212955913-212955935 CTCCTGCAACAGAGGCAGCCAGG - Intronic
922661354 1:227433147-227433169 CTCCTCCCACAGAATGAGCTGGG + Intergenic
1063701430 10:8388591-8388613 CTCCTGCTCCAGTGGGAACCTGG - Intergenic
1063856237 10:10257329-10257351 CTCCTGCTGCACAGACAGCTCGG + Intergenic
1064954165 10:20888617-20888639 CTCCTGCTCCAGGGGGAGAGGGG + Intronic
1065880687 10:30035193-30035215 CACTTCCTACAGAGGGAGCGTGG + Intronic
1066451428 10:35533537-35533559 CACCTGGGACAGAGGGAGCTGGG - Intronic
1067820503 10:49524659-49524681 CTCCTGTTTCTGAGGGATCTGGG + Exonic
1068839172 10:61590946-61590968 CTACTGCTTCAGTGTGAGCTGGG + Intergenic
1070537973 10:77393562-77393584 CCCCTGAGACAGATGGAGCTGGG + Intronic
1070909394 10:80104322-80104344 CTCCCGCCATGGAGGGAGCTAGG + Intergenic
1071519441 10:86319905-86319927 CTGCTGTCACCGAGGGAGCTAGG - Intronic
1072924003 10:99600257-99600279 CTGCTGCTAGAGAGGGGCCTAGG - Intergenic
1073327469 10:102651002-102651024 CTCCTGCTACAGACAGCGCCTGG - Intronic
1073509300 10:104033416-104033438 CTCCTGCTGAAGAGGGTACTGGG - Intronic
1075233756 10:120708409-120708431 GTCCTGCAACAGTGGAAGCTCGG - Intergenic
1076195169 10:128512628-128512650 CCCCTGCTCCAGAGGAAGCTGGG + Intergenic
1076249965 10:128977848-128977870 CTCCTGCTCCAGCGGGGCCTGGG - Intergenic
1076458776 10:130623880-130623902 CTTCTGCCACAGAGGAAGCAGGG + Intergenic
1077056308 11:595513-595535 CTCCACCTGCACAGGGAGCTTGG - Intronic
1077141305 11:1026119-1026141 CTCCTGCTCAAGGGGGAGGTGGG - Exonic
1077183841 11:1227822-1227844 CTCCAGGTCCAGGGGGAGCTGGG + Intronic
1078134497 11:8640752-8640774 CTCCTGCTCCACGGGGGGCTGGG + Exonic
1080421951 11:32118272-32118294 TTCCTGCTCCAGAGGGACCCAGG - Intergenic
1081748453 11:45489398-45489420 CTCCCGATGCAGGGGGAGCTGGG + Intergenic
1083574395 11:63779230-63779252 CTCTGGCTACAAAGGAAGCTAGG + Intergenic
1083793842 11:65003138-65003160 GTCCTGCTACTGTGTGAGCTTGG + Intergenic
1084921336 11:72472856-72472878 CTCTTTCTACAGAGGGGTCTGGG + Intergenic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1089300018 11:117492920-117492942 CTCATGCTTCAGGTGGAGCTTGG - Intronic
1089356194 11:117855559-117855581 CTCCTTCCAGAGAGGAAGCTGGG + Intronic
1090903054 11:131049328-131049350 CTCCAGGTACAAAGGAAGCTAGG - Intergenic
1091122854 11:133070999-133071021 GTTCACCTACAGAGGGAGCTTGG + Intronic
1091994496 12:4982580-4982602 CCCCTGCTTCAGAGGGAGCCAGG - Intergenic
1092229846 12:6770290-6770312 CCCCTGCCACACAGGGATCTGGG - Intronic
1094688846 12:32748875-32748897 CTCCTGCAAAAGAGGCACCTGGG + Intronic
1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG + Intergenic
1099621343 12:85005858-85005880 CTCTTGCATCAGAGTGAGCTGGG + Intergenic
1104415827 12:128596072-128596094 GTCCTGGTACAGAGGCAGCAGGG + Intronic
1104415944 12:128596655-128596677 GTCCTGGTACAGAGGCAGCAGGG + Intronic
1104802917 12:131566855-131566877 TTCTGGCTCCAGAGGGAGCTGGG + Intergenic
1106509100 13:30397815-30397837 CTCCTTCTACAGAGGGAAGATGG + Intergenic
1113828692 13:113277169-113277191 AACCTGGTACAGAGAGAGCTTGG + Intergenic
1115365755 14:32555244-32555266 CACTTGCTAGAGATGGAGCTGGG + Intronic
1118213875 14:63790001-63790023 CTCATTCTACAGAGGGAGGGTGG - Intergenic
1118816401 14:69317333-69317355 CTCCTGCTCCAGTGGGAGTCAGG + Intronic
1120020919 14:79529024-79529046 GTCCTGCTACAGCGGGAGAATGG - Intronic
1121635819 14:95453261-95453283 CTCCTGGGATTGAGGGAGCTGGG - Intronic
1122156736 14:99754471-99754493 CTCCTCCCACACAGGGAGCCAGG - Intronic
1122859644 14:104576806-104576828 CCCCTACGGCAGAGGGAGCTGGG + Intronic
1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG + Intronic
1122859673 14:104576953-104576975 TCACTGCCACAGAGGGAGCTGGG + Intronic
1124441490 15:29689160-29689182 CTCCTGCTCCTGAGTGAGCCCGG + Intergenic
1125130411 15:36278470-36278492 CTCTTCCCACAGAGGGAGCAGGG - Intergenic
1127774071 15:62252096-62252118 CTCCTCCCACAGTGGGGGCTGGG - Intergenic
1130413482 15:83667807-83667829 AGCCTCCTACAGAGGGAGATTGG + Intronic
1130520389 15:84657210-84657232 CTCCTGCTAAAGAAGGCTCTGGG - Exonic
1131258009 15:90874075-90874097 CTGCTGCTGCTCAGGGAGCTTGG + Intronic
1131771339 15:95741299-95741321 CCCCTACTACAGGGGAAGCTGGG - Intergenic
1132317334 15:100899602-100899624 TTCCTGCTCCTGACGGAGCTAGG - Intronic
1132516404 16:368111-368133 CTCCTCCTACTGAGGGTCCTGGG + Intronic
1132662528 16:1068030-1068052 GTCCAGAGACAGAGGGAGCTGGG - Intergenic
1132669237 16:1095919-1095941 CTCCTCCGGCAGAGGGAGCCTGG + Intronic
1132686274 16:1163434-1163456 CTGCGGCTTCAGAGGGGGCTGGG - Intronic
1133025691 16:2988125-2988147 CTCCTGCCACAGGGGGAGGTGGG + Intergenic
1134248028 16:12554491-12554513 ATCCTGCTGCGGAGGAAGCTTGG - Intronic
1135827662 16:25743854-25743876 ATGTTGCTACAGAAGGAGCTAGG - Intronic
1136065487 16:27755488-27755510 AGCCTGCTCCACAGGGAGCTCGG + Intronic
1138521840 16:57575599-57575621 CTCCTGCTAGAGAGGGTGGCAGG + Exonic
1138664402 16:58552464-58552486 ATCTTGCTACAGTGGGTGCTAGG + Intronic
1139477729 16:67211056-67211078 CTCTGGCTTCAGAGGGTGCTGGG + Exonic
1139550052 16:67667934-67667956 CTCCTCCTGCAGCGGCAGCTTGG - Exonic
1139983506 16:70879566-70879588 CTGCTGCAGGAGAGGGAGCTGGG + Intronic
1141461136 16:84179458-84179480 CTCCTGCTGCAGAGAGACCTGGG - Exonic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1143469343 17:7162017-7162039 CTCCTGCTACACTGGGGGGTGGG + Intergenic
1144367096 17:14555107-14555129 GTCCTGCTACTGAGGGTGCTGGG + Intergenic
1145908887 17:28531459-28531481 CTGCCTCTAGAGAGGGAGCTGGG - Intronic
1147004219 17:37388844-37388866 CTTCTGTTCCAGAGGCAGCTTGG + Intronic
1148986604 17:51628026-51628048 TAACTGCTACAGAGGGAGATTGG + Intergenic
1151151998 17:72096099-72096121 CTCCTGCATCAGGGGTAGCTAGG - Intergenic
1151163257 17:72183511-72183533 CCCCTGCTAGCGAGGGAGCAGGG + Intergenic
1151304451 17:73254035-73254057 CTGCTTCTACAGAGAGTGCTGGG - Intronic
1151734884 17:75933170-75933192 CTCCTAATACAGAGACAGCTTGG - Intronic
1151926829 17:77203880-77203902 CTGCTGCTACACAGGCATCTCGG - Intronic
1152014565 17:77741928-77741950 CTGCTGCTTTAGAGGGAGCCAGG - Intergenic
1152639540 17:81443907-81443929 CTGCTGCTGCAGTGAGAGCTGGG + Exonic
1152708536 17:81858626-81858648 CCCGTGCTACAGACGGAGCAGGG + Intronic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154254018 18:12767347-12767369 CTTCTGCAACTGTGGGAGCTGGG - Intergenic
1156504149 18:37578230-37578252 CTCCTGCACCACAGGCAGCTAGG + Intergenic
1157271720 18:46281368-46281390 CTCCTGCCAGAGACGGAACTAGG - Intergenic
1157784170 18:50467241-50467263 CCCCAGCTACAGGGGGAGCCTGG + Intergenic
1158041544 18:53100685-53100707 CCTCTGCTACACAGGTAGCTCGG - Intronic
1161157342 19:2739518-2739540 TTTGTGCTACAGAGGGAGCTAGG + Intronic
1162015634 19:7845160-7845182 CTCCTGCTACAGAGCGTGCCGGG + Intronic
1163647070 19:18495562-18495584 CTTCAGCTGCAGTGGGAGCTGGG - Intronic
1164050629 19:21583455-21583477 CTCCTGCTACAGAGCTTGCTGGG + Intergenic
1164109299 19:22140184-22140206 CTCCTGATGCAGAGGGAGGCTGG + Intergenic
1165432572 19:35781009-35781031 ATCCTGCGACAGAGGGTGTTTGG + Exonic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1165742759 19:38213437-38213459 CACCTGCTTCAGAGGGTGGTTGG + Intronic
1166181430 19:41111970-41111992 CTCCTGCTACAGAGGGAACTTGG - Intergenic
1166504219 19:43361440-43361462 CTCCTGGGACAGGGGCAGCTGGG - Exonic
1166506240 19:43373318-43373340 CTCCTGGGACAGGGGCAGCTGGG + Intergenic
1166523972 19:43499437-43499459 CTCCTGGGACAGAGGGAGAAGGG + Intronic
1166754534 19:45182256-45182278 TTCCAGCTACTCAGGGAGCTGGG + Intronic
1166933937 19:46319882-46319904 TTCCTTTTACAGAAGGAGCTTGG + Intronic
1167669009 19:50839032-50839054 CTCCTGGGTCTGAGGGAGCTGGG + Intergenic
926426185 2:12740537-12740559 ATCTTGCTGAAGAGGGAGCTGGG - Exonic
927861234 2:26561561-26561583 GGACTGCTGCAGAGGGAGCTGGG + Intergenic
929948414 2:46387993-46388015 CTCCTGCTCCTGGGGGTGCTGGG + Intergenic
929995188 2:46821590-46821612 TTCCTGCCACACAGAGAGCTTGG - Intronic
930777387 2:55187167-55187189 CTCCTGCTTCAGGAGTAGCTGGG - Intronic
932211039 2:69930775-69930797 CTCCTTCTACAGAGGAAGCTAGG + Intronic
933805912 2:85997926-85997948 CTCCTTCTACAGAGGGTGATAGG - Intergenic
934852212 2:97708458-97708480 CTCCTGGCTCAAAGGGAGCTTGG - Intergenic
935157998 2:100500978-100501000 CTCTTCCTACCAAGGGAGCTAGG - Intergenic
936491788 2:112978521-112978543 CTCATTCTAGACAGGGAGCTGGG - Intronic
942264301 2:174205696-174205718 TTCCTGCCACAGAGTGAGCAAGG + Intronic
942289557 2:174455453-174455475 CTCCTGCTTCAGAGGCTGCAAGG - Intronic
947370634 2:229442014-229442036 CCCTTGCTACAGATGCAGCTGGG + Intronic
1170945940 20:20891112-20891134 CCCCTGCCCCAGGGGGAGCTGGG - Intergenic
1171489769 20:25508649-25508671 CTTCTACAACAGGGGGAGCTGGG + Intronic
1172870723 20:38134024-38134046 CTACTGCTAAAGAGGGAGATTGG + Intronic
1173071575 20:39773459-39773481 CACCTGCAACAGAGAGTGCTGGG + Intergenic
1175191188 20:57213088-57213110 CTCCTGCCCCAGACAGAGCTCGG + Intronic
1175247188 20:57589316-57589338 CGCCTGCTTCAGGGGGATCTTGG - Intergenic
1175674067 20:60931811-60931833 CTCCTGCTACAGAGGAAGTAGGG - Intergenic
1175803427 20:61813944-61813966 CTCCTGCTACATATTGGGCTGGG - Intronic
1179232770 21:39519864-39519886 CGCCAGTTACAGAGGGAACTGGG + Intergenic
1179729741 21:43360987-43361009 CCCCCGCTACACAGGGACCTGGG - Intergenic
1179776914 21:43670561-43670583 CTCCCTCTACAGAGGCAGATCGG - Intronic
1180086424 21:45509835-45509857 CTCCGCCTACAGCGGCAGCTGGG + Intronic
1183235660 22:36615014-36615036 CCTCTGCTAGAGAGGGAGATAGG - Intronic
1183285514 22:36960085-36960107 CTCTTGCCACTCAGGGAGCTGGG - Intergenic
1185171020 22:49294747-49294769 GTCCTGCCACAAAGGGAGCTGGG - Intergenic
1185298759 22:50068192-50068214 CACCTGCTTCACAGGGACCTGGG - Intronic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
950089387 3:10284716-10284738 CCCCTACCACAGAGGGTGCTAGG - Intronic
950379489 3:12599353-12599375 CTGCTGCTATGGAGGGAGCATGG - Intronic
953439777 3:42907380-42907402 CACCAGCCACAGAGGCAGCTAGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
957459074 3:80494235-80494257 CCCCTGCTTTAGAGGGAGTTTGG - Intergenic
960637358 3:119796568-119796590 TTTCTGCTACAGAAGGAGCAAGG - Intronic
961063946 3:123858102-123858124 CTCCTGCTACAGAGGCTCTTGGG + Intronic
961449351 3:126995443-126995465 GTCCCCCTACAGAGGAAGCTGGG + Intronic
962204554 3:133424159-133424181 CTCCTGCCTCAGAAGTAGCTGGG + Intronic
963604058 3:147399036-147399058 CTCCTCCTACAGGAAGAGCTTGG + Intronic
964376127 3:156050869-156050891 CTCCTGATACTGTGAGAGCTTGG + Intronic
966823977 3:183948068-183948090 CTGCTGCTACTGAAGGAGCATGG + Intronic
967173565 3:186842994-186843016 ATCCTGCTACAGAGCGAACTGGG - Intronic
967522310 3:190447082-190447104 CTCCTGCTATACAGAGAGCATGG + Intronic
967859835 3:194142060-194142082 CCCCGGCTACACAGGGAGCTCGG - Intergenic
968374563 4:28111-28133 CTTCTGCTGGAGAGGCAGCTAGG + Intergenic
968919767 4:3516496-3516518 CTCCTGCTTCAGAGGCAGCCAGG - Intronic
968921696 4:3525576-3525598 TTCCTGCTCCAGAAGGATCTGGG - Intronic
969031993 4:4222947-4222969 CTCCTCCCAGAGAGGCAGCTGGG + Intronic
969108999 4:4829582-4829604 CTCCTTCCACGAAGGGAGCTGGG - Intergenic
969392554 4:6901236-6901258 CTCCAGCCACAGAGGGGCCTTGG + Intergenic
969581996 4:8071146-8071168 CTGCCCCCACAGAGGGAGCTGGG - Intronic
969957613 4:10907893-10907915 CTCCTAGTTCAGAGGGGGCTAGG + Intergenic
977146278 4:93444332-93444354 GGCCTGCTAAAGAGGGAGCTAGG + Intronic
977223963 4:94372729-94372751 CACCTGCTACAGATGGAACTTGG + Intergenic
978900465 4:113943314-113943336 CTCCTGCGACACAGGGGCCTAGG + Intronic
978927072 4:114259898-114259920 CTCCAGCTAAAGAGAGAGCAAGG - Intergenic
979062992 4:116090112-116090134 TTTCTGCTTCAGAGGGAACTGGG + Intergenic
983413816 4:167429876-167429898 CCCATCCTACAGAGGGAGATTGG - Intergenic
984810458 4:183791850-183791872 CTACTGCTGCAGCGGGAGATAGG + Intergenic
984993387 4:185403859-185403881 CTCCTGCCTCAGCAGGAGCTGGG - Intronic
987143644 5:14970033-14970055 CTCCTTCAAGAGAGGGAGGTAGG + Intergenic
993440610 5:87952605-87952627 CCCCTGCTACTCAGGAAGCTGGG - Intergenic
994458219 5:100041761-100041783 CACCTGTTACAGAGAGAGCAGGG + Intergenic
995960825 5:117836889-117836911 CTCCTGCTTCAGGGGGATATTGG - Intergenic
997002667 5:129781037-129781059 CTCCAGCTACATAGGGAGGCTGG - Intergenic
997599655 5:135130635-135130657 CCCTTGCTCCAGAGGGAGGTTGG - Intronic
998955820 5:147437153-147437175 CTGCTTCTTAAGAGGGAGCTGGG - Intronic
1000211013 5:159105872-159105894 CTCCTTCTACCAAGGGAGCAGGG - Intergenic
1000406194 5:160890824-160890846 CTCCAGCTACTCAGGAAGCTGGG - Intergenic
1001391524 5:171383295-171383317 TTCCTGGTTCAGACGGAGCTTGG - Intergenic
1002755539 6:156166-156188 CTTCTGCTGGAGAGGCAGCTGGG + Intergenic
1002765696 6:236751-236773 CTCCAGCAAGAGAGGGAGCGGGG - Intergenic
1004547206 6:16609378-16609400 CCTCTGCTACAAAGGGGGCTTGG + Intronic
1005040654 6:21596632-21596654 CTCCGGCTGCAGAGGGGGCAAGG - Exonic
1005859865 6:29892078-29892100 CTCCTGATCCTGAGGGAGGTGGG - Intergenic
1005969332 6:30749093-30749115 TTCCTGCCACACAGGAAGCTAGG + Intergenic
1006425769 6:33962016-33962038 CTCCTGTTGCAGTGGGAGCAGGG + Intergenic
1006444137 6:34069444-34069466 CGGCTGCTCCAGAGTGAGCTGGG + Intronic
1007114603 6:39334714-39334736 CTGCTGCTACATAGGGGACTGGG + Exonic
1007790582 6:44306111-44306133 TTCCTGCTGCAGAGGGGTCTGGG + Intronic
1009490901 6:64289444-64289466 CTCCTGCCATAGAGGGAAATTGG - Intronic
1011429960 6:87274971-87274993 TCACTGCTACAGAGGGACCTAGG - Intergenic
1012834842 6:104252043-104252065 CTACTGTAACAGAGGGAGCAAGG + Intergenic
1013288341 6:108699164-108699186 CTCCTTCCACACAGGGAGGTGGG + Intergenic
1014641559 6:123916880-123916902 CTCTTGATACAGAGAGAGGTAGG - Intronic
1016838096 6:148499488-148499510 GTCCTTGTACACAGGGAGCTTGG + Intronic
1016887342 6:148970524-148970546 CTCCTGATACAGAGGTAACCTGG - Intronic
1018512487 6:164540452-164540474 CCCCTGCTCTAGAGGGAGCATGG - Intergenic
1019097214 6:169592020-169592042 CTCCTGCCACGGAAGGTGCTTGG - Intronic
1021103244 7:16607820-16607842 CTTCTGTTACTGAGGAAGCTGGG - Intronic
1024135839 7:46407066-46407088 CTCCTAAAACAGAGGGAGCCTGG + Intergenic
1024512677 7:50215829-50215851 CTCATGTTCCAGGGGGAGCTTGG + Intergenic
1029128497 7:98312223-98312245 CTCCTGCCACCGAGGCAGCTTGG + Exonic
1029504108 7:100951689-100951711 CTCCTGCATCAGAGGCAGCTTGG - Intronic
1030680603 7:112430126-112430148 CTCATTCCACAGAGGGAGTTAGG + Intronic
1031940540 7:127784334-127784356 GTCATGCTAGAGAGGGAGCCAGG - Intronic
1032093224 7:128922614-128922636 GGGCTGCTACAGGGGGAGCTTGG - Intergenic
1034186269 7:149179574-149179596 CTCCTGCCACAGTAGGAGCAGGG - Exonic
1034272992 7:149812292-149812314 CTCCGGCTACAGTGGGACCAGGG - Intergenic
1035451345 7:158979129-158979151 CTACAGCTGCAGATGGAGCTGGG + Intergenic
1035455625 7:159006810-159006832 TTCCCGCCACAGAGGGAGGTTGG + Intergenic
1042614395 8:70632702-70632724 CTCCAGCCACAGGGGTAGCTGGG + Intronic
1042788466 8:72576585-72576607 GTCCTGCTGCAGAGGGAGAAAGG - Intronic
1045276808 8:100714000-100714022 CTCCTACTTTAGAGGGAGTTAGG - Intronic
1045288951 8:100815619-100815641 CTCCTGCTCCAGAGCCAACTTGG + Intergenic
1047290503 8:123525452-123525474 CTCATTCTACAGAGAGAGCTAGG + Intronic
1048230741 8:132638472-132638494 CTCCTACTACAGAGGGCACCTGG + Intronic
1048965182 8:139609762-139609784 CACCTGCAACAGAGGGTGTTGGG + Intronic
1049058150 8:140255085-140255107 GACGTGCTCCAGAGGGAGCTTGG - Intronic
1049658856 8:143810806-143810828 CACCTGCTGCAGAGGATGCTGGG - Exonic
1049830898 8:144700248-144700270 CTCCTTCTCCTGAGGGAGCCAGG + Intergenic
1053271002 9:36749488-36749510 CTCCTGTTAGAGAGGGTGCAAGG + Intergenic
1057009266 9:91587100-91587122 TCCCTGTTACACAGGGAGCTGGG - Intronic
1057141963 9:92731870-92731892 CTCCTGATGCACAGGCAGCTGGG + Intronic
1057896560 9:98913549-98913571 CTCATGCCACAGAGGAAGGTAGG + Intergenic
1058405074 9:104663569-104663591 CTCCTGCCCCAGCAGGAGCTGGG - Intergenic
1059542239 9:115142600-115142622 CTCCTGCTTCAGTGGGAACAGGG + Intronic
1060054640 9:120403006-120403028 CTCCTGCGACAGTGGCAGTTCGG - Exonic
1060406973 9:123377628-123377650 CTCCTGCTGTGGAGGCAGCTGGG + Exonic
1060495237 9:124113473-124113495 CTGTGGCTGCAGAGGGAGCTAGG + Intergenic
1061064216 9:128267384-128267406 CTCCTCCCACAGCGGGGGCTGGG - Intronic
1062232836 9:135491698-135491720 CTCCCCCTACATAGGGAGGTGGG - Intergenic
1062538261 9:137030334-137030356 CCTCTGCTACCGAGGAAGCTCGG + Exonic
1062558376 9:137127588-137127610 GTCCTGCTACAGAGGTAGCATGG - Intergenic
1203574656 Un_KI270744v1:166039-166061 CTTCTGCTGGAGAGGCAGCTAGG - Intergenic
1186615108 X:11177963-11177985 CTCTTCCTACAGAGACAGCTAGG + Intronic
1186872071 X:13783077-13783099 CTCCTTCTATAGTGGGAACTTGG + Intronic
1187792354 X:22964698-22964720 CTCCTGTCACAGAGAGTGCTGGG + Intergenic
1188905366 X:35785287-35785309 ATCCTGCTACATTGGGACCTGGG - Intergenic
1191202128 X:57794820-57794842 CTCCTGGTAAGGAGGGAGTTTGG + Intergenic
1195081855 X:101378712-101378734 CTGTTGCTCCATAGGGAGCTGGG - Intronic
1198158529 X:133985448-133985470 ATCCTGCTTCGCAGGGAGCTAGG + Exonic
1199852672 X:151736716-151736738 TTCCTGGTACAGAAGGAGCAGGG + Intergenic
1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG + Intronic
1201855098 Y:18532731-18532753 GTGCTGCTACACTGGGAGCTGGG - Intergenic
1201878223 Y:18787653-18787675 GTGCTGCTACACTGGGAGCTGGG + Intronic