ID: 1122859673

View in Genome Browser
Species Human (GRCh38)
Location 14:104576953-104576975
Sequence TCACTGCCACAGAGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 2, 2: 2, 3: 27, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122859669_1122859673 -7 Left 1122859669 14:104576937-104576959 CCTCAGCTGGGTGTTTTCACTGC 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1122859673 14:104576953-104576975 TCACTGCCACAGAGGGAGCTGGG 0: 1
1: 2
2: 2
3: 27
4: 254
1122859664_1122859673 26 Left 1122859664 14:104576904-104576926 CCACTACAGCAGAGAGAGCTGGG 0: 1
1: 1
2: 4
3: 19
4: 270
Right 1122859673 14:104576953-104576975 TCACTGCCACAGAGGGAGCTGGG 0: 1
1: 2
2: 2
3: 27
4: 254
1122859662_1122859673 27 Left 1122859662 14:104576903-104576925 CCCACTACAGCAGAGAGAGCTGG 0: 1
1: 1
2: 2
3: 25
4: 245
Right 1122859673 14:104576953-104576975 TCACTGCCACAGAGGGAGCTGGG 0: 1
1: 2
2: 2
3: 27
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122859673 Original CRISPR TCACTGCCACAGAGGGAGCT GGG Intronic
900844824 1:5088840-5088862 TCACTGCCTCAGAGGCAGCAGGG - Intergenic
901023157 1:6265242-6265264 TCACTGCCCCAGAGAGACGTGGG + Intronic
901260705 1:7868611-7868633 TCACTGCCACACAGGGCGACAGG - Intergenic
903966833 1:27095978-27096000 CCCCTGCCAGAGAGGGAGCCGGG - Intergenic
904771238 1:32882473-32882495 TCCCTGGCAGAGAGGGGGCTGGG + Intergenic
905751078 1:40464529-40464551 TCACTGGCACATAGTGAACTGGG - Intergenic
907096682 1:51787960-51787982 TAACTGCCACAGAGGGAAAAGGG - Exonic
907514603 1:54985761-54985783 TGACTGCCACACAGGAAGCTGGG - Intronic
911232263 1:95373783-95373805 TCAGTGCCACACTGGGTGCTGGG + Intergenic
912458426 1:109815434-109815456 TTACTGCCACAGAGGGAAATAGG - Intergenic
915583489 1:156830383-156830405 TCACTGGGATAGAGGTAGCTGGG + Intronic
919575494 1:199303660-199303682 TCACTGCTACAGAGAAAGCATGG - Intergenic
919988467 1:202692128-202692150 TCACTGCGACAGAGGGAGGGAGG + Intronic
920291226 1:204924470-204924492 TCAGCCCCAGAGAGGGAGCTGGG - Intronic
921226090 1:213020969-213020991 TAGCTGCCACAGAAGGATCTGGG + Intergenic
1062933588 10:1368856-1368878 CGACTGCCACAGGGCGAGCTCGG - Intronic
1064821689 10:19342829-19342851 ACACTGCCACAGAGAGAGGAGGG - Intronic
1065774561 10:29107398-29107420 TCAGTGCCAGAGAGGAAGCTGGG + Intergenic
1067258358 10:44664985-44665007 TAACTGGCAGAGTGGGAGCTGGG - Intergenic
1068743372 10:60500637-60500659 TCACTGGCACAGAAGCAACTGGG + Intronic
1069911281 10:71761369-71761391 TCACTGTCACAAATGGAGCCAGG + Intronic
1073418574 10:103405227-103405249 TCTCTGCCTCTGAGGGAGCGTGG + Intronic
1074755270 10:116619958-116619980 TCACTGCTACAGAAGAACCTAGG - Intergenic
1075084017 10:119402032-119402054 TCAGTGCCACAGAGGAAGAGAGG + Intronic
1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG + Intronic
1078336137 11:10464770-10464792 CCACAGACAAAGAGGGAGCTGGG - Intronic
1080947803 11:36994665-36994687 TCTCTTCCACAGAGGAAGCAAGG + Intergenic
1084773167 11:71357387-71357409 TCCCTCCCTCACAGGGAGCTTGG - Intergenic
1085914757 11:80872405-80872427 TCCATTCCACAGAGGGAGGTTGG - Intergenic
1086498820 11:87431471-87431493 TCACTGTGGCAGAGGGAGCCAGG + Intergenic
1086796741 11:91114530-91114552 TAACTGCCACAGAGGGAAAAGGG + Intergenic
1090479620 11:127056589-127056611 ACATGGCCACAGAGGGCGCTGGG + Intergenic
1090913222 11:131140202-131140224 TCACTGCCCACAAGGGAGCTGGG - Intergenic
1092229846 12:6770290-6770312 CCCCTGCCACACAGGGATCTGGG - Intronic
1092787252 12:12038299-12038321 CCACTGCCATAGTGGGAGCAGGG + Intergenic
1094825297 12:34264793-34264815 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1094855861 12:34402531-34402553 TCACAGCCACAGAGGGCCTTGGG + Intergenic
1095085262 12:38053312-38053334 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1095742348 12:45621192-45621214 CCATTGCCATAGAGGGAGCCTGG + Intergenic
1096280562 12:50249213-50249235 TCAGTGCCAGGGAGAGAGCTGGG + Intronic
1097008611 12:55936648-55936670 TCAAAGCCACTGAGGAAGCTGGG - Intronic
1101346265 12:103889108-103889130 TCAGGGACACAGAAGGAGCTGGG + Intergenic
1102727948 12:115081938-115081960 TCACTCCCAAAGGGAGAGCTGGG + Intergenic
1103240567 12:119409887-119409909 TAACTGTCAGAGAGGGAGGTGGG - Intronic
1103815962 12:123656674-123656696 GCACTGCCACTTAGGGAGATGGG - Intronic
1104100115 12:125599586-125599608 TCCCTGCCACAGAATGAGCATGG - Intronic
1104704134 12:130930441-130930463 TAAGTGCCACAGAGGAAGCATGG - Intergenic
1105332567 13:19431876-19431898 CCACTGCCAGAGAGGTAGCAGGG - Intronic
1105847138 13:24302939-24302961 TCCCTTCCACAAAGGCAGCTGGG - Exonic
1105879118 13:24587901-24587923 CCACTGCCAGAGAGGTAGCAGGG + Intergenic
1105920719 13:24961151-24961173 CCACTGCCAGAGAGGTAGCAGGG - Intergenic
1106689015 13:32093737-32093759 TCACTGTCACTCAGTGAGCTGGG + Intronic
1106861247 13:33911192-33911214 TCAGTTCAACAGAGGCAGCTGGG - Intronic
1108509915 13:51147318-51147340 TCACAGGCACGGAGGGAGCTAGG - Intergenic
1108625857 13:52228340-52228362 CCACTGCCAGAGAGGTAGCAGGG - Intergenic
1108660206 13:52578140-52578162 CCACTGCCAGAGAGGTAGCAGGG + Intergenic
1109117702 13:58409748-58409770 TCACTGACACTGAGGGTGCAAGG - Intergenic
1112919260 13:104590814-104590836 TTACTGCCCAAGAGGAAGCTGGG - Intergenic
1113679940 13:112236220-112236242 GCCCTGCCACAGAAGGACCTGGG - Intergenic
1113836147 13:113329903-113329925 TCAATGCCAAGGAGGGAGCTGGG + Intronic
1113992985 14:16042735-16042757 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1114074240 14:19146328-19146350 TGACTGTCACAGAAGGAGCAAGG + Intergenic
1114088028 14:19253647-19253669 TGACTGTCACAGAAGGAGCAAGG - Intergenic
1114446935 14:22795867-22795889 TCTCTGCCTCAGAAGAAGCTGGG - Intronic
1115391562 14:32860479-32860501 ACAGAGCCACAGAGGGAGCCAGG - Intergenic
1115437070 14:33387266-33387288 ACACTTCCACAGAGGCAGCTTGG + Intronic
1116127684 14:40808947-40808969 TCTCTGTCACTGAGGAAGCTAGG - Intergenic
1117008785 14:51449246-51449268 TGACTGCCACAGGGAGAGCTTGG - Intergenic
1117742801 14:58835275-58835297 TCACAGCAACACAGGGAGATGGG - Intergenic
1119032446 14:71203236-71203258 TAACTGCTGCAGAGGGATCTAGG + Intergenic
1120331776 14:83102541-83102563 TCAGGGACACAGATGGAGCTGGG + Intergenic
1122859614 14:104576661-104576683 CCACTGTAGCAGAGGGAGCTGGG + Intronic
1122859620 14:104576708-104576730 TCACTGCCCCAGAGGGAGCTGGG + Intronic
1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG + Intronic
1122859673 14:104576953-104576975 TCACTGCCACAGAGGGAGCTGGG + Intronic
1122859682 14:104577002-104577024 CCACTGCAGCAGAGAGAGCTGGG + Intronic
1122859690 14:104577051-104577073 TCACTACCACAGAGGGAGCTGGG + Intronic
1122867358 14:104613268-104613290 TCTCCTCCACAGAGGGAGCTGGG - Intergenic
1123936188 15:25195259-25195281 TCACTGCCAGGGAGGCTGCTGGG - Intergenic
1124475883 15:30034153-30034175 TCACTGCCAAAGAGGGATTTGGG + Intergenic
1124880655 15:33639633-33639655 TCATTACCCCAGTGGGAGCTGGG + Intronic
1128672810 15:69586947-69586969 TCAGAGCCACAGAGGGACTTGGG + Intergenic
1129317264 15:74752478-74752500 TGACTGGCACAGAGGGCACTGGG - Intronic
1133413392 16:5587038-5587060 TCTCAGCCCCAGAGGGAGCCAGG + Intergenic
1136912352 16:34154487-34154509 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1136932550 16:34432307-34432329 ACACAGCCACAGAGGGAGAGAGG - Intergenic
1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG + Intergenic
1138096263 16:54214358-54214380 TAGCTGCCACAGAGGGACCTAGG + Intergenic
1138419523 16:56890218-56890240 TCACCTCCCCAGTGGGAGCTGGG + Intronic
1139090038 16:63634336-63634358 GCTCTGGCACAGAGGGAGATGGG - Intergenic
1139747594 16:69087136-69087158 TGAGTGCCACAGAGGAATCTAGG - Intergenic
1140454946 16:75099526-75099548 TCACTGCCCAAGGGAGAGCTTGG - Intronic
1141152479 16:81573753-81573775 ACACTGCCACCCAGGGAGGTAGG - Intronic
1141669118 16:85482258-85482280 TCACTGGCACTGGGGGTGCTCGG + Intergenic
1144564910 17:16352487-16352509 GCACTGCCAGGGAGGGAGCAGGG - Intronic
1144727159 17:17507677-17507699 TCACTGCCACACAGCCTGCTGGG + Intronic
1145913105 17:28553930-28553952 TCCTTGCCACAGAGGGAGACAGG + Exonic
1146289611 17:31598171-31598193 TCACTGACCCTGAGGAAGCTGGG + Intergenic
1146591673 17:34132925-34132947 TCTCCTCCACAGAGGGACCTAGG + Intronic
1148986604 17:51628026-51628048 TAACTGCTACAGAGGGAGATTGG + Intergenic
1150077171 17:62202446-62202468 TGACTGCCACAGAGAGAGAAAGG + Intergenic
1151948278 17:77331292-77331314 TCACTGCGTCAGAGGGAGAGAGG + Intronic
1152034569 17:77864139-77864161 TCACTTTCACAGAGGCAGCTGGG + Intergenic
1152425890 17:80218498-80218520 ACATTGCCTCTGAGGGAGCTGGG - Intronic
1153637791 18:7128172-7128194 TCTCTTCCACAGTAGGAGCTGGG + Intergenic
1155295131 18:24377243-24377265 TCTCTGACTCAGAGGGGGCTAGG + Intronic
1156366606 18:36433425-36433447 TCATTTCCACACAGGGAGTTTGG - Intronic
1157006319 18:43589079-43589101 CCACAGCCTCATAGGGAGCTGGG - Intergenic
1157161481 18:45318024-45318046 TCCCAGCCTCAGCGGGAGCTAGG + Intronic
1157542655 18:48522873-48522895 TCACTGCAACGCAAGGAGCTAGG - Intergenic
1157557901 18:48624724-48624746 TGATTGCCACAGTGGGAGCAGGG + Intronic
1158132589 18:54169404-54169426 TCAGTGCTTCAGAGGGAGCAGGG + Intronic
1158591913 18:58785156-58785178 TCACTGGCCCAGAGGAAGCAAGG + Intergenic
1160623085 18:80184442-80184464 TCTCAGCCACAGAGGGAGCAAGG + Intronic
1161157342 19:2739518-2739540 TTTGTGCTACAGAGGGAGCTAGG + Intronic
1163398314 19:17076655-17076677 ACACTGGCACAGAGGGTGTTGGG - Intronic
1164399138 19:27890845-27890867 TCACTGCCAGGGCCGGAGCTTGG - Intergenic
1165480611 19:36061525-36061547 TCACTGCCACAGGGGAATTTGGG - Intronic
1167696931 19:51020291-51020313 TCACGGCCACAGAGTGGGCGTGG - Intergenic
1168001148 19:53446992-53447014 ACGCTGCAACAGTGGGAGCTGGG - Intronic
1168316733 19:55487892-55487914 TCACTGTCCCAGAGGGAGCTGGG - Intergenic
925306967 2:2854799-2854821 TCACTGTTACAGTGGTAGCTCGG - Intergenic
925382005 2:3434961-3434983 TCGTTGCCACAGAGGGTGATCGG - Intronic
925385481 2:3459146-3459168 TCACAGCCTCAGAGGCAGCCAGG + Intronic
927257559 2:21053426-21053448 TCACTGCCAGAGAAGGAGATGGG + Intergenic
927453927 2:23232983-23233005 TCACTGCCACAGAGCATGATGGG + Intergenic
927861234 2:26561561-26561583 GGACTGCTGCAGAGGGAGCTGGG + Intergenic
928706127 2:33951640-33951662 TCAATGCCACTGAAGGAGCCTGG - Intergenic
929995188 2:46821590-46821612 TTCCTGCCACACAGAGAGCTTGG - Intronic
930139389 2:47936155-47936177 TCACTGGCACAGAGGAAGGAGGG - Intergenic
931778882 2:65563222-65563244 TCACTGCTGCAGAGTGAGCTGGG - Intergenic
932120283 2:69092630-69092652 TGATTGCCACAGAGGTAGATCGG + Intronic
932564392 2:72896444-72896466 TCGGTGCCCCAGAGGGACCTGGG - Intergenic
932576677 2:72966080-72966102 ACACTGCAACTGAGGGAGCCTGG - Intronic
933269121 2:80214617-80214639 TCACAGCCAGAGAGAGAGGTCGG - Intronic
934161378 2:89252833-89252855 TAACAGCCACAGATGGCGCTGGG + Intergenic
934205902 2:89929582-89929604 TAACAGCCACAGATGGCGCTGGG - Intergenic
937626273 2:124047399-124047421 TCACTGGTACACAGAGAGCTTGG + Intronic
937926964 2:127175020-127175042 TCTCTGCCTTAGACGGAGCTCGG - Intergenic
938295210 2:130173735-130173757 TGGCTTCCTCAGAGGGAGCTGGG - Intronic
938488567 2:131742826-131742848 TGACTGTCACAGAAGGAGCAAGG + Intronic
938538717 2:132268147-132268169 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
938842275 2:135174847-135174869 CCACAGCCACAGAGGAGGCTGGG - Intronic
939232292 2:139444448-139444470 TTACCTCCACAGAGGCAGCTTGG + Intergenic
939350966 2:141036941-141036963 TCACTGCCACAGGAGGAGAAGGG + Intronic
942264301 2:174205696-174205718 TTCCTGCCACAGAGTGAGCAAGG + Intronic
943074826 2:183180990-183181012 TCATTGCCTCAGATGGAGGTAGG - Intergenic
943465015 2:188218153-188218175 TCCCTGGCACAGAGGGAGGAGGG - Intergenic
944813499 2:203351361-203351383 TTTCTGCCACAAAGGCAGCTGGG + Intronic
946025494 2:216669600-216669622 TCACCAACACAGAGGGAGATGGG + Intergenic
946389517 2:219407084-219407106 TCACAGCCTCAGAGGGATGTAGG + Intergenic
946804046 2:223452065-223452087 TCACAGGCACAGGGGCAGCTTGG + Intergenic
947757174 2:232574996-232575018 TCTCTGTAGCAGAGGGAGCTGGG + Intronic
948094742 2:235324664-235324686 TCTCTGCAAAGGAGGGAGCTGGG + Intergenic
948313284 2:237006058-237006080 TCTCTTTCACAGAGGGAGCTTGG + Intergenic
949053345 2:241909793-241909815 TCACAGCTAAAGAGGCAGCTTGG - Intergenic
1169651601 20:7874378-7874400 GCACTGGCAAAGAGGGAGATTGG - Intergenic
1170442371 20:16391740-16391762 TCATGGCCCAAGAGGGAGCTAGG + Intronic
1170945940 20:20891112-20891134 CCCCTGCCCCAGGGGGAGCTGGG - Intergenic
1171867632 20:30500110-30500132 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1171907636 20:30912634-30912656 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1172008186 20:31831453-31831475 TCACTGCCACCTAGGAAGCTGGG + Intronic
1172125884 20:32624973-32624995 TCTCTGCCACAAGGGGAGCAGGG + Intergenic
1173018843 20:39250183-39250205 TCAGTGCCACATAGGGTTCTCGG - Intergenic
1173598033 20:44272381-44272403 TCATTGGCTGAGAGGGAGCTGGG + Intronic
1173705967 20:45110538-45110560 TCACTGCAACACAGGGAACTGGG + Exonic
1173805000 20:45918956-45918978 TCACTGCCACCCAGGGAGGTAGG - Intergenic
1174600825 20:51723455-51723477 TCCCAGCCACACAGGGGGCTGGG + Intronic
1177292067 21:19126539-19126561 TCCCTACCACAGTGAGAGCTGGG - Intergenic
1178396330 21:32246792-32246814 TGTCTGCCAGAGCGGGAGCTGGG + Intergenic
1179478998 21:41665992-41666014 TCTCGACCCCAGAGGGAGCTGGG - Intergenic
1180289884 22:10839268-10839290 TGACTGTCACAGAAGGAGCAAGG + Intergenic
1180314283 22:11264784-11264806 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1180341075 22:11618767-11618789 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1180492681 22:15868690-15868712 TGACTGTCACAGAAGGAGCAAGG + Intergenic
1180998857 22:19978609-19978631 TGACAGCCAGAGGGGGAGCTGGG - Intronic
1181581011 22:23828013-23828035 TCTCTGCCACACAGAAAGCTTGG + Intronic
1182271180 22:29154528-29154550 GCTCTGCCGCAGCGGGAGCTGGG - Intronic
1182389556 22:29981076-29981098 TAACTGTCACAGAGGGAACTGGG - Intronic
1184038252 22:41928680-41928702 CCACTGCCACAGGGGATGCTGGG + Intergenic
1184659796 22:45960504-45960526 TCCCTGCCACCCAGAGAGCTGGG - Intronic
1184723341 22:46328828-46328850 GTACTGCCACAGAAGTAGCTCGG + Exonic
1184876837 22:47281625-47281647 TCACTGCCACAGTGTGAGTTGGG + Intergenic
1185171020 22:49294747-49294769 GTCCTGCCACAAAGGGAGCTGGG - Intergenic
949535020 3:4988888-4988910 TCCCTTCCAGAGAGAGAGCTTGG - Intergenic
950089387 3:10284716-10284738 CCCCTACCACAGAGGGTGCTAGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
954134908 3:48577828-48577850 TCACAGACACATAGGGAGTTAGG - Intronic
954135324 3:48579658-48579680 TCTCTGCCACAGGGAGAGCCTGG - Exonic
954406927 3:50350401-50350423 TCCCTGCCACATTGGGAGCCGGG + Intronic
960179657 3:114560578-114560600 GCACTACCACAGAGGGAGACAGG - Intronic
961034379 3:123632226-123632248 TCACAGAGACAGAGAGAGCTGGG - Intronic
961073832 3:123963463-123963485 TCACTAGCATAGAGGGTGCTTGG + Intergenic
961200795 3:125043765-125043787 TCACACCCAGAGAGGAAGCTGGG + Intronic
961972583 3:130986101-130986123 TCACTGCCACCCAGAGAGCTGGG + Intronic
967224125 3:187274938-187274960 CCACCGTCTCAGAGGGAGCTGGG + Intronic
967825482 3:193873958-193873980 TCACTACCACACAAGCAGCTGGG - Intergenic
970064674 4:12079046-12079068 TCAATGCCAGAGAGGCATCTTGG - Intergenic
973719118 4:53705560-53705582 TTAGTTCCAGAGAGGGAGCTAGG + Intronic
974256999 4:59470671-59470693 TCAGTGGAAGAGAGGGAGCTAGG - Intergenic
977265065 4:94844305-94844327 TATCTGTAACAGAGGGAGCTGGG - Intronic
977839951 4:101690698-101690720 TCACTGCAAAAGAGGGACTTAGG - Intronic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
981033467 4:140149371-140149393 AGGCTGCCACAGAGGGGGCTGGG - Intronic
981677781 4:147359729-147359751 TCACTGCCAAAGAAAGAGCAGGG - Intergenic
982523986 4:156454558-156454580 TCACAGCTACTCAGGGAGCTGGG + Intergenic
984812885 4:183810469-183810491 TCATTGCCAAAGAAAGAGCTGGG + Intergenic
989491010 5:42053546-42053568 ACACTACAACAGAGTGAGCTAGG + Intergenic
990491303 5:56305606-56305628 TCACTGCTAGAGAGGCAGCCAGG - Intergenic
992754987 5:79895622-79895644 TCAGGGCCATGGAGGGAGCTTGG + Intergenic
993384978 5:87252324-87252346 CCACTGCGCCAGTGGGAGCTGGG - Intergenic
995334591 5:110984444-110984466 TCACGCCCACAGACGGAGATGGG - Intergenic
997222773 5:132182705-132182727 TGACTGAAGCAGAGGGAGCTGGG + Intergenic
998157252 5:139794066-139794088 TAAAGGGCACAGAGGGAGCTTGG - Intergenic
998805145 5:145911417-145911439 GCTCTGCCACAGAGGGAGAAGGG + Intergenic
998979987 5:147691359-147691381 TCACAGTAACAGAAGGAGCTGGG - Intronic
998992353 5:147831860-147831882 CCACAACCACAGAGGGAGTTAGG - Intergenic
999170509 5:149590158-149590180 ACACTGGCACAGAGGGATTTGGG - Intronic
1000347286 5:160325020-160325042 CCACGGCCACAGAGCAAGCTAGG - Intronic
1002056278 5:176599561-176599583 TGACGGCCCCAGAGGGAGCCTGG - Exonic
1002405850 5:179030391-179030413 TCACTGCCACAAAAGGAGGAGGG + Intronic
1002633740 5:180596953-180596975 ACGGTGCCACAGAGGGCGCTCGG - Intergenic
1003232953 6:4271386-4271408 TTAGGGCCACAGAGGGACCTTGG + Intergenic
1003355410 6:5364914-5364936 TCCCTGCCCCAGAGATAGCTAGG - Intronic
1003815264 6:9833065-9833087 TCGCAGCCCCAGAGGGAGCATGG + Intronic
1004305552 6:14498674-14498696 CCACTTCCATAGTGGGAGCTCGG + Intergenic
1005822329 6:29608149-29608171 CCACTGCCACACAGGGAGGAGGG - Intronic
1005969332 6:30749093-30749115 TTCCTGCCACACAGGAAGCTAGG + Intergenic
1007165442 6:39825631-39825653 TCACAGCCACGGTGGGAGCAGGG - Intronic
1008725996 6:54420138-54420160 TCACCGCCACAGAGGAAAATAGG - Intergenic
1011429960 6:87274971-87274993 TCACTGCTACAGAGGGACCTAGG - Intergenic
1011545867 6:88480703-88480725 TCCGTGCCAGAGAGGGAGCGAGG - Intergenic
1013156414 6:107495116-107495138 TGAATGCCACAGTGGGATCTGGG - Intronic
1013613479 6:111818588-111818610 TCATTACCATGGAGGGAGCTGGG - Intronic
1016536274 6:145110196-145110218 TGAATGGCACAAAGGGAGCTGGG + Intergenic
1016609801 6:145975990-145976012 TTACTGCCACAGAAGAAGTTAGG - Intergenic
1017980021 6:159393264-159393286 TCCCTGGCACAGAGAAAGCTTGG - Intergenic
1018748401 6:166780428-166780450 TCACAGCCCCAGCGGGAGCCAGG + Intronic
1019409652 7:900926-900948 CCAGGGCCACAGAGTGAGCTTGG - Intronic
1020072190 7:5234388-5234410 TCCCTGCCACAGAGAGAACTGGG + Intergenic
1020116629 7:5479915-5479937 TCACTGGCACAGGTGGATCTGGG - Intronic
1022782838 7:33603207-33603229 TCCCTGAGACAGAGGGAGGTGGG - Intronic
1024706422 7:51965690-51965712 TCACTGGCACAGTTGAAGCTAGG + Intergenic
1024989654 7:55223193-55223215 TCCCTGCCCCAGAGGCAGGTGGG + Intronic
1025171446 7:56760970-56760992 TAACTGGCACAGAGGGAGAAAGG - Intergenic
1025700421 7:63814512-63814534 TAACTGGCACAGAGGGAGAAAGG + Intergenic
1025831968 7:65060152-65060174 TAACTGGCACAGAGGGAGAAAGG + Intergenic
1025919656 7:65899581-65899603 TAACTGGCACAGAGGGAGAAAGG + Intronic
1027426346 7:78065088-78065110 TAACTGCCACAGAGCAGGCTGGG + Intronic
1028211094 7:88076086-88076108 TCACTGCAACAGCGCGATCTCGG + Intronic
1029129489 7:98319147-98319169 TCACTGCCACATGGGGGTCTGGG + Intronic
1029788975 7:102822568-102822590 TTACTGTCACAGTGGGAGTTAGG + Intronic
1032502428 7:132409989-132410011 TCAATTCCAAAGAGGGAGCAGGG - Intronic
1033719105 7:144038001-144038023 TCACAGCCACTGAGGGAGGGAGG + Intergenic
1035038182 7:155908784-155908806 GGGCTGCCACAGAGGGACCTGGG + Intergenic
1035455625 7:159006810-159006832 TTCCCGCCACAGAGGGAGGTTGG + Intergenic
1035626698 8:1076341-1076363 TCACTGCCACGTAGTGAGCTGGG - Intergenic
1037519184 8:19663110-19663132 TGAATGCCACAAAGGGATCTGGG - Intronic
1037562309 8:20086045-20086067 TCACTGCCACAGGGGACACTGGG + Intergenic
1039176873 8:34818342-34818364 ACATTGCCTCAGAGAGAGCTTGG - Intergenic
1039411637 8:37359962-37359984 TCACTCCCAGAGAGGCAGCCAGG + Intergenic
1039774102 8:40718922-40718944 TCAGTGCCACAGGGGAACCTTGG - Intronic
1039976508 8:42371049-42371071 TCAGTGCCACAAAGGGAACCTGG - Intronic
1040013515 8:42681837-42681859 TCATGGTGACAGAGGGAGCTAGG + Intergenic
1041118090 8:54560133-54560155 TCACTCCCCCAGGAGGAGCTGGG - Intergenic
1041700572 8:60784527-60784549 TCACTGTCAGGGAGAGAGCTTGG + Intronic
1044603216 8:94026269-94026291 TCACTGTCACAGCGGGGACTGGG + Intergenic
1045527185 8:102951025-102951047 AAACAGCCACAGTGGGAGCTGGG + Intronic
1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG + Intronic
1047059058 8:121202638-121202660 TAGTTGCCACAGAGGTAGCTGGG - Intergenic
1047843556 8:128780888-128780910 TGACTGCCTCAGAGGAAGCTAGG + Intergenic
1050274426 9:3981936-3981958 TATCTGCCACAGAGGGAGAGAGG + Intronic
1053480703 9:38414457-38414479 GCTCTGCCACAGATGGTGCTGGG - Intronic
1054812776 9:69447868-69447890 TCCCTGCCCCCCAGGGAGCTTGG - Intronic
1057009266 9:91587100-91587122 TCCCTGTTACACAGGGAGCTGGG - Intronic
1060590269 9:124811889-124811911 TCAGTGTCACACTGGGAGCTGGG + Exonic
1060822951 9:126671982-126672004 TCACGGCCACAGCTGGGGCTCGG - Intronic
1061807699 9:133145601-133145623 TCACAGCCACCCTGGGAGCTGGG + Intronic
1186189211 X:7052704-7052726 TTACTTTCACAGAGGGAACTTGG + Intronic
1186405729 X:9300727-9300749 TCACTTCCTGAGAGGGAGTTGGG - Intergenic
1190188772 X:48258106-48258128 GCAATGCCACAGAGACAGCTGGG - Intronic
1192446318 X:71214192-71214214 TCACTGCTAGAAAGGGAGCCAGG - Intergenic
1196597594 X:117563318-117563340 TCATTGTCACAAAGGGAGCATGG - Intergenic
1197765570 X:130057441-130057463 ACAATGCCACAGAGGGGGCGGGG - Exonic
1199737191 X:150695184-150695206 TCACTAGCAGGGAGGGAGCTAGG + Intronic
1201070618 Y:10144586-10144608 GCACAGCCAGAGATGGAGCTTGG - Intergenic