ID: 1122859690

View in Genome Browser
Species Human (GRCh38)
Location 14:104577051-104577073
Sequence TCACTACCACAGAGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122859686_1122859690 -7 Left 1122859686 14:104577035-104577057 CCTCAGCTGGGCGTTTTCACTAC 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1122859690 14:104577051-104577073 TCACTACCACAGAGGGAGCTGGG 0: 1
1: 1
2: 1
3: 18
4: 162
1122859681_1122859690 26 Left 1122859681 14:104577002-104577024 CCACTGCAGCAGAGAGAGCTGGG 0: 1
1: 2
2: 2
3: 47
4: 424
Right 1122859690 14:104577051-104577073 TCACTACCACAGAGGGAGCTGGG 0: 1
1: 1
2: 1
3: 18
4: 162
1122859679_1122859690 27 Left 1122859679 14:104577001-104577023 CCCACTGCAGCAGAGAGAGCTGG 0: 1
1: 1
2: 5
3: 40
4: 332
Right 1122859690 14:104577051-104577073 TCACTACCACAGAGGGAGCTGGG 0: 1
1: 1
2: 1
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122859690 Original CRISPR TCACTACCACAGAGGGAGCT GGG Intronic
900844824 1:5088840-5088862 TCACTGCCTCAGAGGCAGCAGGG - Intergenic
901928426 1:12581784-12581806 TCACCAGCACAGAGGGAGAAAGG + Intronic
906539419 1:46573658-46573680 TCACTACAGCAGAGCAAGCTAGG - Intronic
907514603 1:54985761-54985783 TGACTGCCACACAGGAAGCTGGG - Intronic
911061556 1:93752175-93752197 TCACTACCACAGAGTGTGAAGGG + Intronic
911285541 1:95987668-95987690 TCACTATCACAGAGGAAATTAGG + Intergenic
912458426 1:109815434-109815456 TTACTGCCACAGAGGGAAATAGG - Intergenic
915684063 1:157613464-157613486 TCAGTAACACAGATAGAGCTGGG + Intergenic
919988467 1:202692128-202692150 TCACTGCGACAGAGGGAGGGAGG + Intronic
920139063 1:203794519-203794541 CCACTACCCCAGGGGGACCTTGG + Intergenic
920291226 1:204924470-204924492 TCAGCCCCAGAGAGGGAGCTGGG - Intronic
922225753 1:223644875-223644897 TGACTAATACAGAGGGATCTAGG - Intronic
924650462 1:245921832-245921854 GCACTACTAGAGAGGGAGGTAGG + Intronic
1064551765 10:16508432-16508454 TCACTACCACAAAGGGGCTTCGG - Intronic
1065432008 10:25668276-25668298 TCACTAACAAAGGGTGAGCTTGG - Intergenic
1065774561 10:29107398-29107420 TCAGTGCCAGAGAGGAAGCTGGG + Intergenic
1069776241 10:70928939-70928961 TGACAACCACAAAGGGAGCCTGG - Intergenic
1071284447 10:84131653-84131675 ACTCTAACACAGAAGGAGCTAGG - Intergenic
1080947803 11:36994665-36994687 TCTCTTCCACAGAGGAAGCAAGG + Intergenic
1083981662 11:66176233-66176255 AGACTACCAGAGATGGAGCTAGG - Intronic
1084773167 11:71357387-71357409 TCCCTCCCTCACAGGGAGCTTGG - Intergenic
1085357835 11:75855502-75855524 TAACTACCATAGGAGGAGCTGGG + Intronic
1085389992 11:76177428-76177450 TCCCTACCAGAGAGGGGCCTGGG - Intergenic
1085914757 11:80872405-80872427 TCCATTCCACAGAGGGAGGTTGG - Intergenic
1087757991 11:102074433-102074455 ACACAAGCACAGAAGGAGCTGGG - Intronic
1089611579 11:119672358-119672380 TCATTACCCCAGAGGGAGAAGGG + Intronic
1089934426 11:122349159-122349181 TCACTAACAGAGAGGGTGTTAGG + Intergenic
1092150889 12:6247634-6247656 TCTGTACCACACTGGGAGCTGGG + Intergenic
1092224002 12:6734649-6734671 TGACAACCACCGAGCGAGCTGGG - Intergenic
1094825297 12:34264793-34264815 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1095085262 12:38053312-38053334 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1095252265 12:39992396-39992418 TTACTACCACAGAGGTGGCAGGG + Intronic
1099327267 12:81233652-81233674 TCACTACCACCCAGGGATGTGGG - Intronic
1102143497 12:110636692-110636714 CCACAACAACAGAGGCAGCTGGG - Intronic
1102727948 12:115081938-115081960 TCACTCCCAAAGGGAGAGCTGGG + Intergenic
1105847138 13:24302939-24302961 TCCCTTCCACAAAGGCAGCTGGG - Exonic
1106861247 13:33911192-33911214 TCAGTTCAACAGAGGCAGCTGGG - Intronic
1108509915 13:51147318-51147340 TCACAGGCACGGAGGGAGCTAGG - Intergenic
1112159671 13:96854321-96854343 TGACAACCACTGAGTGAGCTTGG - Intergenic
1113699859 13:112376270-112376292 TCACAACCAGGAAGGGAGCTGGG - Intergenic
1113836147 13:113329903-113329925 TCAATGCCAAGGAGGGAGCTGGG + Intronic
1113992985 14:16042735-16042757 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1115437070 14:33387266-33387288 ACACTTCCACAGAGGCAGCTTGG + Intronic
1117008785 14:51449246-51449268 TGACTGCCACAGGGAGAGCTTGG - Intergenic
1119438379 14:74612309-74612331 TCATTACCGGAGAGGGAGCGAGG + Exonic
1121426724 14:93857541-93857563 TCACTACCACAGCTACAGCTTGG - Intergenic
1122607934 14:102960236-102960258 TCAAAACCACAGGGGCAGCTGGG + Intronic
1122859620 14:104576708-104576730 TCACTGCCCCAGAGGGAGCTGGG + Intronic
1122859634 14:104576757-104576779 CCACGACAGCAGAGGGAGCTGGG + Intronic
1122859644 14:104576806-104576828 CCCCTACGGCAGAGGGAGCTGGG + Intronic
1122859665 14:104576904-104576926 CCACTACAGCAGAGAGAGCTGGG + Intronic
1122859673 14:104576953-104576975 TCACTGCCACAGAGGGAGCTGGG + Intronic
1122859690 14:104577051-104577073 TCACTACCACAGAGGGAGCTGGG + Intronic
1122867358 14:104613268-104613290 TCTCCTCCACAGAGGGAGCTGGG - Intergenic
1124475883 15:30034153-30034175 TCACTGCCAAAGAGGGATTTGGG + Intergenic
1124834964 15:33187611-33187633 TGACTACAACTGAGAGAGCTGGG + Intronic
1124880655 15:33639633-33639655 TCATTACCCCAGTGGGAGCTGGG + Intronic
1128877723 15:71215603-71215625 TCAGAACCACAGAGTGAGGTGGG - Intronic
1129677979 15:77642663-77642685 TCCATACCACACAGGGAGCAAGG + Intronic
1133242075 16:4420709-4420731 TTACTACCTCAGAGTGAGTTAGG - Intronic
1134729977 16:16453599-16453621 TCACGACCACAAACGGAGTTTGG - Intergenic
1134937456 16:18258301-18258323 TCACGACCACAAACGGAGTTTGG + Intergenic
1136912352 16:34154487-34154509 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1138096263 16:54214358-54214380 TAGCTGCCACAGAGGGACCTAGG + Intergenic
1138287535 16:55821576-55821598 TCAGGACCACAGATGGGGCTAGG + Intronic
1138419523 16:56890218-56890240 TCACCTCCCCAGTGGGAGCTGGG + Intronic
1141818772 16:86431043-86431065 TCAGTATCACAGAGGGCTCTTGG - Intergenic
1143535626 17:7537506-7537528 TCACAACCACACTGGGAGGTGGG + Intergenic
1146591673 17:34132925-34132947 TCTCCTCCACAGAGGGACCTAGG + Intronic
1148740057 17:49887636-49887658 TCACTACCACAAAGGGAAGAAGG - Intergenic
1148986604 17:51628026-51628048 TAACTGCTACAGAGGGAGATTGG + Intergenic
1152034569 17:77864139-77864161 TCACTTTCACAGAGGCAGCTGGG + Intergenic
1152151874 17:78606384-78606406 TCACAACCACCCTGGGAGCTAGG - Intergenic
1153637791 18:7128172-7128194 TCTCTTCCACAGTAGGAGCTGGG + Intergenic
1155143338 18:23063288-23063310 TCAGTAGGACATAGGGAGCTGGG - Intergenic
1156366606 18:36433425-36433447 TCATTTCCACACAGGGAGTTTGG - Intronic
1160175832 18:76593157-76593179 CCACCACGACAGTGGGAGCTAGG + Intergenic
1160603978 18:80035193-80035215 ACGCTAACACAGGGGGAGCTGGG - Intronic
1160623085 18:80184442-80184464 TCTCAGCCACAGAGGGAGCAAGG + Intronic
1162015451 19:7844444-7844466 TCAGAACCACAGATGGAGTTGGG - Intronic
1164525511 19:29010462-29010484 TCCCTACCACACACGGTGCTGGG - Intergenic
1166563539 19:43749230-43749252 TGACTAGCACAGAGGAAGCAGGG + Intronic
1168316733 19:55487892-55487914 TCACTGTCCCAGAGGGAGCTGGG - Intergenic
927257559 2:21053426-21053448 TCACTGCCAGAGAAGGAGATGGG + Intergenic
929098374 2:38285714-38285736 TCACCACCACAGAGAAGGCTGGG + Intergenic
930705722 2:54502965-54502987 TCATGACCACAGAGGGAACATGG - Intronic
931778882 2:65563222-65563244 TCACTGCTGCAGAGTGAGCTGGG - Intergenic
932731994 2:74227955-74227977 TCCTGACCACAGAGGCAGCTAGG + Intronic
938295210 2:130173735-130173757 TGGCTTCCTCAGAGGGAGCTGGG - Intronic
938538717 2:132268147-132268169 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
939232292 2:139444448-139444470 TTACCTCCACAGAGGCAGCTTGG + Intergenic
946022506 2:216650767-216650789 TTACTACCACAAAGGAAACTGGG + Intronic
946025494 2:216669600-216669622 TCACCAACACAGAGGGAGATGGG + Intergenic
947669597 2:231927803-231927825 TCACTACCACGGAGGGAAGAGGG - Intergenic
948313284 2:237006058-237006080 TCTCTTTCACAGAGGGAGCTTGG + Intergenic
948322763 2:237083927-237083949 TATCTACAACTGAGGGAGCTGGG + Intergenic
1171867632 20:30500110-30500132 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1171907636 20:30912634-30912656 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1172008186 20:31831453-31831475 TCACTGCCACCTAGGAAGCTGGG + Intronic
1173705967 20:45110538-45110560 TCACTGCAACACAGGGAACTGGG + Exonic
1173805000 20:45918956-45918978 TCACTGCCACCCAGGGAGGTAGG - Intergenic
1177292067 21:19126539-19126561 TCCCTACCACAGTGAGAGCTGGG - Intergenic
1178921084 21:36738683-36738705 CCACTACAACAGTGGGAGGTGGG - Intronic
1179478998 21:41665992-41666014 TCTCGACCCCAGAGGGAGCTGGG - Intergenic
1180314283 22:11264784-11264806 CCACTTCCCCAGAGGCAGCTTGG - Intergenic
1180341075 22:11618767-11618789 CCACTTCCCCAGAGGCAGCTTGG + Intergenic
1182158125 22:28095116-28095138 TCAGTACCACTCTGGGAGCTGGG + Intronic
1182389556 22:29981076-29981098 TAACTGTCACAGAGGGAACTGGG - Intronic
1184489873 22:44802366-44802388 TCATTAGCACAGTGGGAGCCAGG + Intronic
1184876837 22:47281625-47281647 TCACTGCCACAGTGTGAGTTGGG + Intergenic
949535020 3:4988888-4988910 TCCCTTCCAGAGAGAGAGCTTGG - Intergenic
949860970 3:8504472-8504494 TCCCTACCCCCGAGGGGGCTGGG + Intronic
950089387 3:10284716-10284738 CCCCTACCACAGAGGGTGCTAGG - Intronic
957124924 3:76146798-76146820 TCATTACCACAGAGTTACCTTGG - Intronic
960179657 3:114560578-114560600 GCACTACCACAGAGGGAGACAGG - Intronic
961073832 3:123963463-123963485 TCACTAGCATAGAGGGTGCTTGG + Intergenic
961200795 3:125043765-125043787 TCACACCCAGAGAGGAAGCTGGG + Intronic
961972583 3:130986101-130986123 TCACTGCCACCCAGAGAGCTGGG + Intronic
962828829 3:139122063-139122085 ACACTAACAGAGAAGGAGCTGGG - Intronic
966868827 3:184277014-184277036 CCAGTACCACAGAGGTAGGTGGG + Exonic
967825482 3:193873958-193873980 TCACTACCACACAAGCAGCTGGG - Intergenic
970467275 4:16337406-16337428 ACACAACCACAGTGGGTGCTGGG - Intergenic
971256883 4:25022545-25022567 ACACAAACACAGAGGGAGCGAGG - Intronic
973719118 4:53705560-53705582 TTAGTTCCAGAGAGGGAGCTAGG + Intronic
978370127 4:108021723-108021745 TCAAAACCACAGACTGAGCTGGG - Intronic
980427442 4:132644752-132644774 ACAGTAGCAGAGAGGGAGCTAGG - Intergenic
980630623 4:135426967-135426989 TCTCTACCACGGAGTGAGCCTGG - Intergenic
984922138 4:184774563-184774585 TCACTACCACTGATGGGGTTCGG + Intronic
986335119 5:6748962-6748984 CCACTACCACAGAATGATCTGGG - Intronic
987753118 5:22066826-22066848 TAACTAACACAGATGGATCTTGG + Intronic
987999764 5:25332730-25332752 TCTCTAGCATAGAGGAAGCTTGG + Intergenic
989491010 5:42053546-42053568 ACACTACAACAGAGTGAGCTAGG + Intergenic
991624416 5:68585104-68585126 CCACTACCACAGAGGAAGGAAGG + Intergenic
993482586 5:88442647-88442669 GCACTACCATGAAGGGAGCTTGG + Intergenic
993601694 5:89933691-89933713 TCACAACCACTGATGGAGCCAGG + Intergenic
995334591 5:110984444-110984466 TCACGCCCACAGACGGAGATGGG - Intergenic
996998551 5:129728685-129728707 TTACTACCACTGTGGAAGCTAGG - Intronic
998508981 5:142695726-142695748 TAGCTACCACAGAGAGGGCTTGG + Intronic
998992353 5:147831860-147831882 CCACAACCACAGAGGGAGTTAGG - Intergenic
1000548721 5:162633321-162633343 TCACTATCACAGGGAGAGCAAGG + Intergenic
1001325442 5:170720418-170720440 TGCTTACCAGAGAGGGAGCTGGG - Intronic
1002009702 5:176268208-176268230 TCACTAGCATAAAGGGAGGTAGG + Intronic
1002217019 5:177644084-177644106 TCACTAGCATAAAGGGAGGTAGG - Intergenic
1002383430 5:178847743-178847765 CCGCAACCACAGAGGGACCTGGG + Intergenic
1004305552 6:14498674-14498696 CCACTTCCATAGTGGGAGCTCGG + Intergenic
1011429960 6:87274971-87274993 TCACTGCTACAGAGGGACCTAGG - Intergenic
1012290027 6:97442861-97442883 TCATTATCACACTGGGAGCTGGG + Intergenic
1013613479 6:111818588-111818610 TCATTACCATGGAGGGAGCTGGG - Intronic
1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG + Intergenic
1019292146 7:256063-256085 ACCCTACGGCAGAGGGAGCTGGG + Intronic
1020072190 7:5234388-5234410 TCCCTGCCACAGAGAGAACTGGG + Intergenic
1020215138 7:6184353-6184375 ACAATACCACAGAGGGGGCCAGG - Intronic
1023557071 7:41435004-41435026 TCACTACCATATTGGGAGATGGG - Intergenic
1026612088 7:71869065-71869087 TCACTACCACAATGGGGGCAGGG + Intronic
1029114971 7:98232090-98232112 TCATTAGCATAGGGGGAGCTGGG - Intronic
1029141926 7:98417486-98417508 TGACCAGGACAGAGGGAGCTGGG - Intergenic
1032502428 7:132409989-132410011 TCAATTCCAAAGAGGGAGCAGGG - Intronic
1032738829 7:134718398-134718420 TAACCACCACAGAGTGACCTTGG - Intergenic
1035626698 8:1076341-1076363 TCACTGCCACGTAGTGAGCTGGG - Intergenic
1036438217 8:8755892-8755914 TCACCACCAGAAAGGGAGCAAGG - Intergenic
1039411637 8:37359962-37359984 TCACTCCCAGAGAGGCAGCCAGG + Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1040856996 8:51958675-51958697 TTCCTACCTCAGAAGGAGCTGGG + Intergenic
1041118090 8:54560133-54560155 TCACTCCCCCAGGAGGAGCTGGG - Intergenic
1044364192 8:91324155-91324177 TCACTACTGTAGAGGGAGGTGGG + Intronic
1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG + Intronic
1047843556 8:128780888-128780910 TGACTGCCTCAGAGGAAGCTAGG + Intergenic
1053417107 9:37953679-37953701 ACCCTAGCACAGAGGGAGGTAGG - Intronic
1062619860 9:137415694-137415716 TCACCATCACAGACGGGGCTGGG + Intronic
1185996790 X:4960419-4960441 TCACTACTCCAGAGAGGGCTTGG - Intergenic
1186189211 X:7052704-7052726 TTACTTTCACAGAGGGAACTTGG + Intronic
1186405729 X:9300727-9300749 TCACTTCCTGAGAGGGAGTTGGG - Intergenic
1188065189 X:25650278-25650300 TCCCTACCACAGAGAGTTCTTGG + Intergenic
1189662284 X:43313361-43313383 TAAATACCACCAAGGGAGCTAGG + Intergenic
1191682522 X:63855964-63855986 TATCTACCATAGAGAGAGCTTGG + Intergenic
1192890053 X:75380774-75380796 TCACTACTACATAGGCAGCAAGG - Intronic
1197355447 X:125433534-125433556 TTACTATCACTGAGGCAGCTAGG - Intergenic
1198860303 X:141061821-141061843 TCCGTAGCACAGTGGGAGCTAGG - Intergenic
1198902388 X:141525569-141525591 TCCGTAGCACAGTGGGAGCTAGG + Intergenic
1199737191 X:150695184-150695206 TCACTAGCAGGGAGGGAGCTAGG + Intronic
1200662236 Y:5973486-5973508 ACACCACCGCAGAGGCAGCTGGG + Intergenic
1200850672 Y:7880046-7880068 TCATTACCACAGAGTAAGTTGGG - Intergenic
1201634567 Y:16108228-16108250 TCACTATCACAGAAAGAGCATGG + Intergenic