ID: 1122861196

View in Genome Browser
Species Human (GRCh38)
Location 14:104583062-104583084
Sequence CCAGTTAGGGAGGGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 352}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122861181_1122861196 23 Left 1122861181 14:104583016-104583038 CCAGGACTTGAGCCAGACCTCTC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG 0: 1
1: 0
2: 3
3: 18
4: 352
1122861180_1122861196 24 Left 1122861180 14:104583015-104583037 CCCAGGACTTGAGCCAGACCTCT 0: 1
1: 0
2: 1
3: 16
4: 199
Right 1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG 0: 1
1: 0
2: 3
3: 18
4: 352
1122861184_1122861196 11 Left 1122861184 14:104583028-104583050 CCAGACCTCTCTTCCAGAAGGGG 0: 1
1: 0
2: 4
3: 36
4: 806
Right 1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG 0: 1
1: 0
2: 3
3: 18
4: 352
1122861186_1122861196 6 Left 1122861186 14:104583033-104583055 CCTCTCTTCCAGAAGGGGAAGCG 0: 1
1: 0
2: 2
3: 11
4: 197
Right 1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG 0: 1
1: 0
2: 3
3: 18
4: 352
1122861187_1122861196 -2 Left 1122861187 14:104583041-104583063 CCAGAAGGGGAAGCGTGAAGCCC 0: 1
1: 0
2: 2
3: 8
4: 87
Right 1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG 0: 1
1: 0
2: 3
3: 18
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122861196 Original CRISPR CCAGTTAGGGAGGGGATGGC AGG Intronic
900333821 1:2150799-2150821 CCAGTTATCGATGGGATGGATGG + Exonic
900409129 1:2504929-2504951 CCGGCTGGGGAGGGGGTGGCAGG + Exonic
900435516 1:2628963-2628985 CCAGGCAGGGAGGGGGTGGGCGG + Intronic
901793536 1:11667275-11667297 CCAGGTAGGTGGGGGTTGGCCGG - Intronic
902571809 1:17351990-17352012 GCAGTCAGGGAGGTGATGGGAGG + Intronic
902571825 1:17352044-17352066 GCAGTCAGGGAGGTGATGGGAGG + Intronic
902571834 1:17352078-17352100 GCAGTCAGGGAGGTGATGGGAGG + Intronic
903389663 1:22954922-22954944 CCAGATGGGGAGTGGATAGCTGG - Intronic
903607925 1:24588663-24588685 CGAGTTTGGGAAGTGATGGCAGG - Intronic
903868231 1:26413292-26413314 CCAGATAGGGAGGGGCTGAGGGG + Intronic
904586054 1:31581278-31581300 GTGGGTAGGGAGGGGATGGCCGG + Intronic
904801092 1:33093433-33093455 CTGGTGTGGGAGGGGATGGCAGG - Intronic
905792728 1:40798932-40798954 CCAACAAGGGAGGGGCTGGCAGG - Intronic
906430244 1:45750372-45750394 CCAGTTGGGGCGGGGGAGGCAGG + Intronic
911620581 1:100063390-100063412 CCAGTTTGGGAGGCCAAGGCAGG + Intronic
911779898 1:101863218-101863240 GCACTTTGGGAGGGGAAGGCAGG - Intronic
912387065 1:109276424-109276446 CCAGTTTGGGAGGCCAAGGCGGG - Intergenic
914440370 1:147700311-147700333 CCAGTCAGGGAGGGGAGGGATGG - Intergenic
916226394 1:162493948-162493970 CCTGTTGGGGATGGGATGGGAGG + Intergenic
917123593 1:171665819-171665841 GCAGTTTGGGAGGGCAAGGCGGG - Intergenic
917876915 1:179294088-179294110 GGAGTTGGGGAGGGGAGGGCGGG + Intronic
918456729 1:184727759-184727781 TAAGTTTGGGAGGGGATGGAGGG - Intronic
919776475 1:201197390-201197412 CTAGTGAGGGAGGGGAGGGGAGG + Intronic
920353434 1:205352789-205352811 CCAGTGAAGGAGGGAGTGGCAGG + Intronic
920448859 1:206041754-206041776 CCCGTGAGGGAGGGGGAGGCAGG + Intronic
921209812 1:212885132-212885154 TCAGTGTGGGAGGGGAGGGCAGG - Intronic
923878242 1:238074694-238074716 CCTGTTAGGGAGGGCCTGGAAGG - Intergenic
924947786 1:248857809-248857831 GCAGGTAGGTAGGGGATGGCAGG - Exonic
1062934340 10:1374890-1374912 CCACTTAGGGAGGGGAAGGCAGG + Intronic
1066661573 10:37741826-37741848 CCAGTGGGGGCGGGGAGGGCAGG + Intergenic
1068090592 10:52428461-52428483 CCAAAAAGGTAGGGGATGGCTGG - Intergenic
1068546508 10:58352500-58352522 CCACTTGGGGAGGGTAGGGCGGG + Intronic
1069980063 10:72246196-72246218 CAAGTTATGGCAGGGATGGCAGG + Intergenic
1070635807 10:78126315-78126337 GCACTTAGGGAGGCCATGGCGGG - Intergenic
1073414372 10:103368598-103368620 CCGGTAAGGCAGGGGCTGGCAGG + Intronic
1073530440 10:104226771-104226793 GCACTTTGGGAGGGGAAGGCAGG + Intronic
1074909193 10:117892038-117892060 CCAGTTAGGAAGGGGAAGGAGGG - Intergenic
1075814800 10:125256686-125256708 CCAGCCAGGGTGGGGATGGAGGG + Intergenic
1076549878 10:131271471-131271493 CCAGGCAGGGAGGGTCTGGCTGG - Intronic
1076870089 10:133188784-133188806 CCAGTTACGCATGGGACGGCAGG - Intronic
1077043116 11:533232-533254 GCAGTGAGGGAGGCGAGGGCCGG - Intronic
1077553956 11:3217218-3217240 CCAGTGTGGGAGGGGATGGGAGG + Intergenic
1078823418 11:14905400-14905422 CGAGTTAGCGAGAAGATGGCTGG + Intronic
1080066312 11:28019098-28019120 CCACTGAGGGAGGTGATGACTGG + Intergenic
1080178356 11:29393918-29393940 CCAGGTAGGGACTGAATGGCAGG - Intergenic
1080458481 11:32435083-32435105 CCACCCAGGGAGGGGACGGCGGG + Exonic
1080465732 11:32495520-32495542 CCAGTTTGGGAGGCCAAGGCGGG - Intergenic
1081460253 11:43266257-43266279 CCACTTAGAGAGGCCATGGCGGG + Intergenic
1081612082 11:44568773-44568795 CCAGGGTGGAAGGGGATGGCCGG - Intronic
1082012820 11:47461862-47461884 ACACTTAGGGAGGGCAAGGCAGG - Intergenic
1082068906 11:47922827-47922849 GCAGTTTGGGAGGCCATGGCAGG - Intergenic
1083348926 11:62013418-62013440 CCAGTGGGGGTGGGGATGGGGGG + Intergenic
1083484169 11:62972846-62972868 GCAGTTTGGGAGGGCAAGGCAGG + Intronic
1084088197 11:66864396-66864418 CCAGACAGCGAGGGGACGGCAGG + Intronic
1084170693 11:67399541-67399563 GAGGTGAGGGAGGGGATGGCTGG - Exonic
1085228988 11:74948674-74948696 TCAGTGAGAGAGAGGATGGCTGG + Intronic
1086037873 11:82438728-82438750 CAAGGTGGGGAGGGGGTGGCAGG + Intergenic
1086843265 11:91716148-91716170 CTAGTTGGGGAAGGGAAGGCAGG - Intergenic
1088020031 11:105108109-105108131 GCAGTTTGGGAGGGCATGGTGGG - Intergenic
1088191816 11:107235611-107235633 CCAGTTAGGGAGCCAATGTCGGG + Intergenic
1089051445 11:115549323-115549345 CCAGTTTAGGAGGGGAGCGCTGG + Intergenic
1089472651 11:118733255-118733277 GCAGTTTGGGAGGCCATGGCGGG + Intergenic
1089630492 11:119781289-119781311 GCAGGTGGGGAGGGGAGGGCTGG - Intergenic
1089679979 11:120113925-120113947 CAAGCCAGGGAGGGGATGGGAGG - Intronic
1090041658 11:123297697-123297719 CCACTTAGGGAGGCCAAGGCAGG - Intergenic
1090058847 11:123446410-123446432 GCAGTTTGGGAGGGCAAGGCGGG - Intergenic
1090424117 11:126595171-126595193 CCACTTGTGGAGGGGGTGGCGGG + Intronic
1090775362 11:129960005-129960027 GCAGTTTGGGAGGGCAAGGCAGG - Intronic
1092276471 12:7064966-7064988 CCAGTTAGGGCAGGGATCTCAGG + Intronic
1092905328 12:13095954-13095976 CCAGTTACCTAGGGAATGGCAGG - Intronic
1093329236 12:17814689-17814711 CCTGTCAGGGAGTGGAGGGCCGG - Intergenic
1093800985 12:23373157-23373179 GCAGTTAGGGAAGGAATGTCAGG + Intergenic
1094480173 12:30875170-30875192 CCAGGCAGGGAGGGGAGGGCTGG + Intergenic
1094561892 12:31562500-31562522 CCAGGTAGGGAGGCTAAGGCAGG + Intronic
1095791607 12:46174211-46174233 CCAGTTTGGGTGGTGGTGGCTGG + Intergenic
1096019393 12:48309998-48310020 CCAGTAATGGAGGAGGTGGCGGG + Intergenic
1096712131 12:53465201-53465223 ACAGGGAGGGAGGGGATGGAAGG - Intronic
1098577351 12:72058261-72058283 ACAGTCAGGGTGGTGATGGCAGG - Intronic
1100652755 12:96608706-96608728 GCAGTTTGGGAGGGTGTGGCGGG - Intronic
1101718149 12:107329073-107329095 CCAGCTAGGCAGGGTATGGGGGG - Intronic
1102183936 12:110933337-110933359 CCAGACAAAGAGGGGATGGCGGG - Intergenic
1102367285 12:112349141-112349163 CCAGTTTGGGAGGCCAAGGCGGG + Intronic
1102723513 12:115037946-115037968 TCAGTTCGTGAGTGGATGGCAGG - Intergenic
1103851903 12:123938840-123938862 ACAGTCAGGGAGGGGAGGCCAGG - Intronic
1104859457 12:131916899-131916921 CCAGTTAGGGTGGGGTGGGCCGG + Intronic
1105520492 13:21126759-21126781 GCAGTTTGGGAGGGCAAGGCAGG + Intergenic
1105555447 13:21443914-21443936 GCAGTTAGGGAGGCCAAGGCAGG + Intronic
1106087752 13:26558151-26558173 CCACTTACGGCGGGGAGGGCGGG - Intronic
1106434230 13:29709529-29709551 TGACTTAGGGAGGGGAAGGCAGG - Intergenic
1106607032 13:31237838-31237860 CCTGTAAGGGACGGGATGTCTGG + Intronic
1108213191 13:48158805-48158827 CCACTTTGGGAGGCCATGGCAGG - Intergenic
1109007983 13:56902485-56902507 CCAGTTTGGGAGGCCAAGGCGGG - Intergenic
1109991142 13:70059414-70059436 CCAGTTTGGGAGGCCAAGGCAGG - Intronic
1110327505 13:74234084-74234106 ACAGGTAGGGAGGGGATAGATGG + Intergenic
1114327108 14:21600585-21600607 CCACTTATAGAGGAGATGGCTGG - Intergenic
1114344266 14:21779218-21779240 GCAGTTTGGGAGGGCAAGGCAGG - Intergenic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1117456148 14:55898904-55898926 AGAGTAAGGGAGGGGAGGGCGGG - Intergenic
1119436186 14:74599410-74599432 CCAGTTGGGGTGGGGTTGGGCGG + Intronic
1120301644 14:82714942-82714964 CAGGAAAGGGAGGGGATGGCAGG - Intergenic
1120540289 14:85742575-85742597 CAAGTTTGGGAGAAGATGGCTGG - Intergenic
1122071493 14:99208255-99208277 CCAGTGGGGGAAGGGATGCCAGG - Intronic
1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG + Intronic
1125403122 15:39325418-39325440 CAATTTAGGGAGGCCATGGCAGG - Intergenic
1125541205 15:40471092-40471114 GTAGTTGGGGAGGGGAGGGCAGG - Exonic
1127545061 15:59985933-59985955 CCATTTTGGGAGGCCATGGCAGG + Intergenic
1127582388 15:60349966-60349988 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582403 15:60350002-60350024 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582418 15:60350038-60350060 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582433 15:60350074-60350096 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582441 15:60350092-60350114 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582449 15:60350110-60350132 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127582457 15:60350128-60350150 GCAGGGAGGGAGGGGAAGGCAGG + Intronic
1127654537 15:61044028-61044050 TGAGTTAGGGAGGGGGTGGGAGG - Intronic
1128303574 15:66582823-66582845 GCACTTAGGGAGGGCAAGGCAGG - Intronic
1128645575 15:69376509-69376531 CAAGTTGGGGAGGGCAGGGCAGG + Intronic
1130333994 15:82943265-82943287 CCAGTGAGGGTGAGGAGGGCTGG + Intronic
1130847304 15:87759241-87759263 CCTGAATGGGAGGGGATGGCAGG + Intergenic
1130857899 15:87857579-87857601 CCAGTGCTGGAGGGCATGGCTGG - Intergenic
1131515978 15:93077036-93077058 CGGGCAAGGGAGGGGATGGCAGG + Intronic
1131622406 15:94081879-94081901 CCAGATAGGCAGGGGAGGGTAGG - Intergenic
1132199835 15:99943778-99943800 CCAGTTGGGGAGGGGGAGGCAGG + Intergenic
1132884539 16:2176823-2176845 CCATCTAGGGTGGGGATGGAGGG - Exonic
1133841174 16:9411054-9411076 CCAGGTAGGGAGGGGCTTCCAGG + Intergenic
1134446070 16:14332510-14332532 GCAGTTTGGGAGGTGAAGGCGGG - Intergenic
1135741673 16:24980603-24980625 CCAGTTAGGGAAGGGAAGCAGGG + Intronic
1136034654 16:27530044-27530066 CCAGCAAGGGAGCGAATGGCAGG + Intronic
1138354937 16:56370005-56370027 AAAGGTAGGGAGGGGAGGGCTGG + Intronic
1138614627 16:58155282-58155304 CCAGTGAGGGAAGGGCTGGGAGG + Intergenic
1138969384 16:62126630-62126652 CCAGTTTGGGAGGAGAGGGAGGG + Intergenic
1139203773 16:65005585-65005607 CCTGTTAGGGAAGGGATGTAGGG + Intronic
1139643658 16:68311375-68311397 CCAGTTAGGGGTGCGATGGTTGG - Exonic
1139950378 16:70665397-70665419 CCAGGTGGGGAGGGCATGGATGG + Intronic
1140138037 16:72225441-72225463 GCAGTTAGGGAGGCCAAGGCGGG + Intergenic
1141682525 16:85553085-85553107 CCAGTTTGTGAGGGGTTAGCGGG + Intergenic
1142400589 16:89856234-89856256 GCGGTGAGTGAGGGGATGGCAGG + Exonic
1142424271 16:89992638-89992660 CCAGGTAGCGGAGGGATGGCTGG + Intergenic
1142547972 17:718756-718778 GCAGTTAGGGAGGTCAAGGCAGG - Intronic
1142618596 17:1151434-1151456 GCAGTTGGGGAGGGCAGGGCTGG - Intronic
1142669738 17:1482671-1482693 CCAGTGCGGGAGGGGAGGGGAGG - Intronic
1142669777 17:1482778-1482800 CCAGTGTGGGAGGGGAGGGCAGG - Intronic
1142675054 17:1508465-1508487 CCAGTTAAGGAGAGGAAGGAAGG - Intronic
1142683396 17:1562875-1562897 CCACTTAAGGACGGGAGGGCGGG - Intergenic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1144675351 17:17158240-17158262 CCAGTTTGGGAAGGGATGTGGGG + Intronic
1145015169 17:19391827-19391849 ACAGTGAGGGAGGTTATGGCAGG - Intergenic
1145059594 17:19724420-19724442 CCAAGTTGGGAGGGGATGGCGGG - Intergenic
1145949538 17:28805286-28805308 CCACTTTGGGAGGCCATGGCAGG + Intronic
1146139236 17:30350446-30350468 ACAGTTTGGGAGGCCATGGCAGG - Intergenic
1147922742 17:43927929-43927951 CCTGTTAGGTAGGGGCTGCCAGG + Intergenic
1147948917 17:44096146-44096168 CCAGCCAGGAAGGGGAAGGCAGG + Intronic
1148181983 17:45612743-45612765 CATGGCAGGGAGGGGATGGCGGG + Intergenic
1148266876 17:46232957-46232979 CATGGCAGGGAGGGGATGGCGGG - Intergenic
1148433353 17:47661351-47661373 GCACTTAGGGAGGCCATGGCAGG + Intronic
1148588313 17:48796700-48796722 CCAGGAAAGGTGGGGATGGCAGG + Intronic
1148637031 17:49156719-49156741 CCAAGGAGGGAGGGGATGGAAGG + Intronic
1149249863 17:54755623-54755645 TCAGGTAGGGATGGGATGGGAGG + Intergenic
1149567653 17:57651444-57651466 CCAGATAGGGAAGGGAGTGCGGG - Intronic
1149922171 17:60670182-60670204 ACAGTTTGGGAGGCGAAGGCAGG + Intergenic
1151035461 17:70793556-70793578 CCAGTAAGGGACGAGAGGGCTGG + Intergenic
1151090575 17:71435441-71435463 CCATTTAGGGAGGTGATAGCGGG + Intergenic
1152020528 17:77777976-77777998 CCAGTTAGGGAGGGAGGAGCCGG - Intergenic
1152074158 17:78148589-78148611 CCAGGTAGGTAGGGGAAGGAGGG + Intronic
1152121945 17:78424194-78424216 TAAGTGAGGGAGGGGCTGGCAGG + Exonic
1152223899 17:79083825-79083847 ACAGGCTGGGAGGGGATGGCCGG + Exonic
1152369861 17:79879995-79880017 GCAGTTTGGGAGGGCAAGGCAGG + Intergenic
1152897591 17:82922025-82922047 CCAGGACGGGAGGGGAGGGCAGG - Intronic
1153893672 18:9540479-9540501 CCAGCTGGGGAGGGGAAGGAAGG + Intergenic
1154202875 18:12311179-12311201 CCAGCTAGGGATGGGAGGGGTGG - Intronic
1154401885 18:14046582-14046604 CCAATAAGGGATGGGATGGCTGG + Intergenic
1155422350 18:25668845-25668867 CCAGTTAGTGAGAGAAGGGCAGG + Intergenic
1155467728 18:26157029-26157051 CCACTTTGGGAGGGCAAGGCAGG - Intronic
1156186942 18:34674473-34674495 AGAGTCAGGGAGAGGATGGCTGG - Intronic
1158593364 18:58795757-58795779 GCAGTTAGGGAGGCCAAGGCGGG + Intergenic
1160823082 19:1067293-1067315 ACAGCTGGGGAGGGGGTGGCCGG + Intronic
1160875237 19:1293718-1293740 CCAGGTAGGGAAGGGCTGGAGGG + Intronic
1161392274 19:4027794-4027816 CCAGTTTGGGAGGTCAAGGCTGG - Intronic
1161575161 19:5051004-5051026 CAGGTTGGGGAGGGGATGCCTGG - Intronic
1162080636 19:8215728-8215750 CCAGTTTGGACGGGGATGGAGGG - Intronic
1162409514 19:10496870-10496892 ACAGTTAGGGAGGCCAAGGCAGG + Intronic
1162871746 19:13591637-13591659 CCAGCTAGGGATCGGATGGGTGG - Intronic
1162998911 19:14353656-14353678 AGAGTGGGGGAGGGGATGGCAGG + Intergenic
1163117239 19:15195930-15195952 CTAGTTAGGGGGGGCACGGCGGG + Intronic
1163420287 19:17210329-17210351 CCAGTTTGAGAGGCCATGGCTGG - Exonic
1164911483 19:32015825-32015847 CAAGTAAGGGAGGAAATGGCTGG - Intergenic
1166791854 19:45403456-45403478 TCACTTAGGGACGGGAGGGCTGG + Intronic
1167322597 19:48805967-48805989 ACAGTCAGGGGAGGGATGGCGGG - Intronic
1167607901 19:50491301-50491323 CCAGGAGGCGAGGGGATGGCGGG + Intergenic
1167857437 19:52254038-52254060 TGAGATAGGGAGGGGCTGGCTGG - Intergenic
1168297975 19:55386990-55387012 CAAGTCAGGGTGGGGATGGATGG + Intronic
925306044 2:2848915-2848937 CCAGGGAGGGAGGGGAGGGAGGG + Intergenic
929458654 2:42085062-42085084 CCACTTAGGGAGGCCAAGGCAGG + Intergenic
929531467 2:42755709-42755731 CCAGAAAGGGAGCGGGTGGCTGG - Exonic
929828236 2:45327245-45327267 CCAGTGTTGGAGGGGGTGGCTGG + Intergenic
931253076 2:60550642-60550664 CCAGTTTGGGAGGGGGTGAGGGG - Intronic
932248709 2:70220828-70220850 ACAGTTAGGGAAGGGATGTGAGG + Intronic
932734100 2:74242204-74242226 CCAGTTAGGGAAGGGCTGGTGGG + Intronic
933377600 2:81499865-81499887 GCAGTTAGGGAGGCCAAGGCAGG - Intergenic
933483078 2:82881721-82881743 CCAGTTGGGGAGGGCATGCAGGG + Intergenic
933809112 2:86021417-86021439 GGAGGTGGGGAGGGGATGGCTGG + Exonic
936088168 2:109483848-109483870 CCAGCTAAGCAGGGGATGGTGGG - Intronic
937114197 2:119392597-119392619 CCAGTTAGGCAGGGGAAAGTTGG - Intergenic
938013417 2:127847395-127847417 CCAGTTTGGGAGGCCAAGGCAGG + Exonic
938259789 2:129887534-129887556 GAAGTGGGGGAGGGGATGGCTGG - Intergenic
938367843 2:130749216-130749238 CTAGTTTGGGATGTGATGGCAGG - Intergenic
938583810 2:132670286-132670308 CGAGTTGGGGTGGGGGTGGCGGG + Intronic
939251169 2:139683397-139683419 CCAGTTTGGGAGGCTAAGGCTGG + Intergenic
939625163 2:144467992-144468014 GCAGTGAGAGAGGGGATGGAAGG + Intronic
940089662 2:149901269-149901291 CCAGTTGGGGAGGAGAAGGAGGG + Intergenic
940858816 2:158751451-158751473 GCAGTTTGGGAGGGCAAGGCAGG + Intergenic
942005970 2:171699885-171699907 GCAGTTAGGGAGGCCAAGGCGGG - Intronic
942157300 2:173144047-173144069 CCACTTAGGGAGGCCAAGGCAGG + Intronic
946300993 2:218824001-218824023 CCAGTTAGGGATGGTGTGACCGG + Intronic
946810579 2:223520320-223520342 GCAGTTTGGGAGGCTATGGCGGG - Intergenic
947334453 2:229067414-229067436 CAAGTAAGGGAGAGGATGGGGGG + Intronic
947870675 2:233436170-233436192 CCAGTGAGGGAAGGGATGGCAGG - Intronic
1170737385 20:19023689-19023711 CAAGTTTGGGAAGGGATGGGGGG - Intergenic
1170814528 20:19701902-19701924 CCAGTGAGGGAGGGACAGGCAGG + Intronic
1172751207 20:37252518-37252540 GCACTTAGGGAGGCCATGGCAGG + Intronic
1173967765 20:47126356-47126378 CAGGTTAGGGAGGTGATGGGTGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175222291 20:57424262-57424284 CCAGATAGGGAGATGATGTCTGG - Intergenic
1175903418 20:62368697-62368719 CAAGTGGGGGAGGGGCTGGCTGG + Intergenic
1177907669 21:26991801-26991823 GCAGTTAGGGAGGCCAAGGCTGG - Intergenic
1177980863 21:27913748-27913770 GCAGTTTGGGAGGTGAAGGCCGG + Intergenic
1178937358 21:36875022-36875044 CCAGTCGGGGAGGGGAGTGCTGG - Intronic
1179199604 21:39204189-39204211 CCACCTAGGAAGGGGATGGAAGG + Intronic
1182381152 22:29889531-29889553 CCACTTTGGGAGGCGAAGGCAGG - Intronic
1182493499 22:30690237-30690259 CCACTTTGGGAGGTGAAGGCAGG - Intergenic
1182522564 22:30892595-30892617 CCAGCAAGGCAGGGGAGGGCCGG + Intronic
1182912380 22:33995908-33995930 CCAGGAAGGTAGGTGATGGCTGG - Intergenic
1183075147 22:35422238-35422260 GCAGTGAGGGAGATGATGGCAGG + Intronic
1183319826 22:37158251-37158273 CAAGATAGGAAGGGGAGGGCTGG + Intronic
1183665081 22:39242432-39242454 GCTGTTGGGGAGGGGGTGGCCGG - Intronic
1183856346 22:40637330-40637352 GCAGATAGGGAGGGGCAGGCAGG - Intergenic
1183898837 22:40990366-40990388 CCAGTGAGGCGGGGGATGGGAGG + Intergenic
1184770460 22:46594148-46594170 GCAGCTGGGGAGGGGCTGGCGGG - Intronic
1184809966 22:46824656-46824678 CCAGTTAGGAGGGTGGTGGCTGG + Intronic
1185067817 22:48640795-48640817 CCAGTTGGGGAGGTGTTGGTGGG + Intronic
1185258609 22:49849581-49849603 GCAGGGAGGGAGGGGACGGCCGG + Intergenic
949321186 3:2812116-2812138 CCTGTTAGAGAGTGGAGGGCGGG + Intronic
949936609 3:9120945-9120967 CCAGGTGGGGAGGGAATGGCTGG + Intronic
950070429 3:10147843-10147865 GCACTTAGGGAGGCTATGGCGGG + Intronic
950576055 3:13832746-13832768 CCTGACATGGAGGGGATGGCAGG + Intronic
952843410 3:37667082-37667104 GGAGTGTGGGAGGGGATGGCAGG + Intronic
953067996 3:39492306-39492328 GCAGTGAGGGAAGGGGTGGCTGG - Intronic
955059191 3:55481923-55481945 CCAGGGAGGGAGGAGATGGGAGG + Intronic
955097164 3:55810704-55810726 CCACTTAGGGAGGCCAAGGCAGG - Intronic
955292083 3:57701503-57701525 CCAGTTTGGGAGGCCAAGGCAGG - Intergenic
956248345 3:67209405-67209427 CAAGTTGGGGATGGGTTGGCTGG + Intergenic
956618065 3:71192894-71192916 CCATTTTGGGAGGGCAAGGCGGG - Intronic
956644643 3:71443997-71444019 CCAGTTGGGCTGGGGCTGGCTGG - Intronic
959387974 3:105736224-105736246 GCAGTGAGGGAGGGGATGAAGGG - Intronic
959513579 3:107240923-107240945 CCAGTCCGGAAAGGGATGGCCGG - Intergenic
960102963 3:113764120-113764142 CCAGTAAGGGAGGCTAAGGCAGG + Intronic
961468854 3:127098848-127098870 CCAGGCAGGGAGGGGAGGCCAGG - Intergenic
961505784 3:127369856-127369878 CCAGTGAGGGTGGGGCTGGGTGG - Intergenic
962350123 3:134650534-134650556 CCCGTTAGGGAGTGGCTGGGAGG + Intronic
963810642 3:149773214-149773236 CCAATAAGGGAGGGACTGGCAGG - Intronic
966124545 3:176560985-176561007 CTAGGTAGGGATGGGATGGTGGG - Intergenic
967395080 3:188999128-188999150 CCAGTTAGGGAGGTGTTGTGTGG + Intronic
968043863 3:195612581-195612603 TCAGGTAGGGAGAGGAGGGCAGG - Intergenic
968325333 3:197809049-197809071 GCAGTTTGGGAGGCCATGGCAGG + Intronic
968583918 4:1407130-1407152 GCAGTTGGGGTGGGGATGGGGGG + Intergenic
969513185 4:7631388-7631410 CCAGGCAGGGAGGGGGTGGGAGG + Intronic
971427700 4:26532407-26532429 CCAGTTAGGAATGGGATAACTGG + Intergenic
972413603 4:38817143-38817165 CCACTTTGGGAGGCGAAGGCGGG - Intronic
972641642 4:40930991-40931013 GCAGTTTGGGAGGGTAAGGCAGG - Intronic
980998841 4:139808697-139808719 ACAGTTTGGGAGGGGATGTTGGG - Intronic
981162414 4:141514257-141514279 CCATTTAAGGAAGGGATGGTTGG + Intergenic
983630896 4:169848252-169848274 CCAGCTAGGGCAGGCATGGCAGG - Intergenic
984638692 4:182141316-182141338 CAAGAGAGGGCGGGGATGGCGGG - Intergenic
984864926 4:184273245-184273267 ACAGATAGGGATGGGATGGTGGG - Intergenic
986444695 5:7811123-7811145 ACAGACAGGGAGGGGAGGGCAGG + Intronic
987071343 5:14339633-14339655 CCAGTTAGGGAGGGCATAGCAGG + Intronic
990292452 5:54366469-54366491 ACACTTAGGGAGGCCATGGCGGG + Intergenic
990306352 5:54497334-54497356 GCTGATAAGGAGGGGATGGCTGG - Intergenic
992987748 5:82250948-82250970 CCAGTTAGGGATGGGAATGAAGG + Intronic
993037144 5:82770426-82770448 GCAGTTAGGGAGGCCAAGGCAGG + Intergenic
995150584 5:108839821-108839843 GCAGTTTGGGAGGCGAAGGCAGG - Intronic
996457251 5:123698965-123698987 CCTGTCAGGGAGGTGAGGGCAGG - Intergenic
997536759 5:134628567-134628589 GCAGTTTGGGAGGCGAAGGCAGG + Intronic
997569341 5:134914111-134914133 CCAGTTAGGCAGGAGAGGACAGG + Intronic
999530402 5:152456654-152456676 CTATTTATTGAGGGGATGGCAGG - Intergenic
1002126895 5:177052427-177052449 CCACTTTGGGAGGTCATGGCGGG - Intronic
1002236663 5:177808161-177808183 GGAGTTAGGGAGGGGCTGGTGGG + Intergenic
1002335989 5:178478616-178478638 ACAGGAAGGGAGGGGTTGGCAGG - Intronic
1002773364 6:308031-308053 CCAGTTGGGGAGGGGCCCGCTGG + Intronic
1003098888 6:3162537-3162559 CCAGGGAGGGAGGGGAAGGAGGG - Intergenic
1004288109 6:14341487-14341509 ACAGTTAGGGAGGAAAAGGCAGG + Intergenic
1005395440 6:25377583-25377605 CCAGTTCTGATGGGGATGGCAGG + Intronic
1006417051 6:33910866-33910888 GCAGGTAGGGAGGGGAGGGCAGG - Intergenic
1008906705 6:56685523-56685545 GCACTTAGGGAGGGCAAGGCAGG + Intronic
1010428954 6:75756577-75756599 GCAGTTTGGGAGGCGAAGGCGGG - Intronic
1011115715 6:83889294-83889316 ACAGCTAGAGAGGGGATGCCTGG + Intronic
1012307251 6:97674281-97674303 CTAGTTAGGGAGGCTAAGGCAGG + Intergenic
1013143930 6:107368605-107368627 CCACTTTGGGAGGGCAAGGCGGG + Intronic
1013501739 6:110759013-110759035 GCACTTAGGGAGGCCATGGCAGG + Intronic
1016739750 6:147514335-147514357 CCAGTGAGGGAGGAGATGGAAGG + Intronic
1017450189 6:154547987-154548009 CCAGTTTGGGAGGCAAAGGCGGG - Intergenic
1019319595 7:409548-409570 TCTGTTAGGGAGGGGGAGGCTGG - Intergenic
1019745660 7:2699349-2699371 CCAGGTAGGGAGGAGACGGTGGG - Intronic
1020197730 7:6055044-6055066 GAAGTTAGGCAGAGGATGGCCGG + Intronic
1021843660 7:24743662-24743684 CCAGTGAGCAAGGGGAGGGCAGG - Intronic
1021937644 7:25646866-25646888 GAAGTTAGGGGTGGGATGGCGGG + Intergenic
1021987451 7:26110607-26110629 CCAGTTAGGCAGGGGCTCGGTGG - Intergenic
1022081424 7:27025580-27025602 CCAGTTTGGGAGGCCAAGGCAGG + Intergenic
1023962149 7:44935795-44935817 CCCCTTAGGGAGTTGATGGCAGG - Intergenic
1024658339 7:51471321-51471343 CCTGTGAGGGAGGGGAAGGAGGG - Intergenic
1024924054 7:54593981-54594003 GCAGATAGGGAGGGCATTGCTGG + Intergenic
1025640582 7:63363933-63363955 CCACTTTGGGAGGCTATGGCAGG - Intergenic
1025642117 7:63384153-63384175 CCACTTTGGGAGGCTATGGCAGG + Intergenic
1026267788 7:68810421-68810443 CCAGTCTGGTAGGGGATGGTGGG + Intergenic
1026943805 7:74303663-74303685 CCACTTTGGGAGGTGAAGGCAGG + Intronic
1028307930 7:89290060-89290082 CCAGTTAGGGACTGGAAGGGTGG - Intronic
1028693858 7:93685247-93685269 CCAGTGAGGGACTGGAAGGCAGG - Intronic
1029272700 7:99386370-99386392 CCAGCTGGGGAGGGGCTGGCAGG + Intronic
1029436532 7:100567035-100567057 CCAGATAGTGAGGAGATGCCGGG - Exonic
1029560406 7:101299521-101299543 CCAGTCTGGAAGGGGAGGGCGGG + Intergenic
1029560946 7:101302710-101302732 CCAGTCTGGAAGGGGAGGGCGGG + Intergenic
1029561817 7:101308204-101308226 CCAGTCTGGAAGGGGAGGGCGGG + Intergenic
1029712430 7:102307105-102307127 CCAGTGGGGGAAGGGAGGGCAGG - Intronic
1030863408 7:114667175-114667197 GCATTTTGGGAGGGGAGGGCAGG + Intronic
1031196476 7:118620899-118620921 CCTGTTGGGGAGTGGAGGGCTGG - Intergenic
1032783723 7:135184596-135184618 CCAGCCAGGGAGGAGAGGGCAGG + Exonic
1033577627 7:142701455-142701477 CCAGTTTGGGAGGGAAGGGAGGG + Intergenic
1034072406 7:148199020-148199042 CAGATTAGGGAGGGCATGGCAGG + Intronic
1034235984 7:149569897-149569919 CCCGCTAGGGAGTGGCTGGCGGG - Intergenic
1034788079 7:153943500-153943522 CCAAGTAGGGAGGGCAGGGCTGG + Intronic
1034897381 7:154886174-154886196 CCAGATAAGGAAGGGATGGTTGG + Intronic
1035346427 7:158202635-158202657 CCATTTAGGGAGGCATTGGCTGG - Intronic
1037029043 8:14079150-14079172 CGAGGGAGGGAGGGGAGGGCTGG + Intergenic
1044053230 8:87535802-87535824 ACAATTAGGGAAGGGAAGGCTGG - Intronic
1044255723 8:90058095-90058117 GCACTTTGGGAGGGGAAGGCAGG + Intergenic
1044846275 8:96385080-96385102 GAAGTTAGGGAGGGGCTGGCAGG - Intergenic
1046493602 8:114985070-114985092 CCAGTAATGAATGGGATGGCTGG + Intergenic
1047264662 8:123294874-123294896 GCAGTTTGGGAGGGCAAGGCGGG - Intergenic
1049003297 8:139839438-139839460 CCAGGTAGTGAGGGGCTGACAGG + Intronic
1049181481 8:141225469-141225491 CCAAGTAGGAAGGTGATGGCTGG - Intronic
1049677358 8:143897136-143897158 GCACTTTGGGAGGGGAAGGCTGG - Intergenic
1050986537 9:12090780-12090802 CCATTTGGGGAGGGGAAGACAGG - Intergenic
1052202633 9:25801440-25801462 CCAGTTTGGGAGGCAAAGGCAGG - Intergenic
1053285028 9:36844764-36844786 GGAGATAGGGAGGGGAGGGCAGG - Intronic
1053306964 9:36991560-36991582 TCAGTCAGGGAGGGGGAGGCTGG - Intronic
1055830799 9:80376394-80376416 CCAGTGAGCGATGGGGTGGCAGG + Intergenic
1059568407 9:115407704-115407726 TCAGTTAAGGAGGAGGTGGCAGG - Intergenic
1060113111 9:120920593-120920615 ACAGTGAAGGAGGGGATGCCAGG - Intronic
1060481114 9:124017444-124017466 CCAGTGCGGGAGGGGAGGGAAGG - Intronic
1060750752 9:126166898-126166920 GCAGAGAGGGAAGGGATGGCTGG + Intergenic
1060756190 9:126215641-126215663 CAAGTGAGTGAGGGGAAGGCCGG - Intergenic
1060937951 9:127526857-127526879 CCAGTGAGGAAGGAGGTGGCAGG + Intronic
1061805270 9:133134217-133134239 CCAAAGAGGGAGGGGATGCCAGG - Intronic
1061939617 9:133876941-133876963 CCAGCTACAGAGGGGAAGGCAGG + Intronic
1062413894 9:136438589-136438611 GCAGGTAGGGAGGGCCTGGCGGG - Exonic
1062457363 9:136646034-136646056 CCAGTCAGGGTGGGGCTGACAGG - Intergenic
1185460899 X:332414-332436 CCCGTGAGGGAGGGGAGGGGTGG + Intergenic
1186082391 X:5947194-5947216 CCAGTAATGGATGGGATTGCTGG + Intronic
1186471711 X:9827098-9827120 CCAGTTAGTCAGGAGATGGAGGG + Intronic
1186589429 X:10914326-10914348 ACACTTAGGGAGGCGAAGGCGGG - Intergenic
1188848866 X:35107463-35107485 CCTGTTAGGGGGGCGAGGGCAGG + Intergenic
1190272245 X:48874733-48874755 GCACTTAGGGAGGCGAAGGCAGG + Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1190431095 X:50378559-50378581 CCAGGTAGGCAGGGGCTGGGTGG - Exonic
1192494085 X:71602431-71602453 GCAGTTTGGGAGGGCAAGGCGGG - Intronic
1193339665 X:80333096-80333118 CTAGTTTTGGAGGGGATGGTAGG + Intergenic
1193821826 X:86174371-86174393 CCACTTTGGGAGGTGAAGGCAGG - Intronic
1195197112 X:102509703-102509725 ACATTTTGGGAGGGGAAGGCAGG - Intergenic
1195699196 X:107689588-107689610 CCAGATAGGGAGTGGAAGGTGGG + Intergenic
1195751996 X:108169150-108169172 CCATTTAGTGAGAGGTTGGCTGG - Intronic
1196098625 X:111825792-111825814 CCAAGTAGGGAGGAGATGGCTGG + Intronic
1196141106 X:112264712-112264734 CCAGTGTGGGAGGGGATTGGTGG - Intergenic
1198917697 X:141691965-141691987 GCACTTTGGGAGGGGAAGGCAGG + Intronic
1199728404 X:150606964-150606986 CCATTTTGGGAGGGGAGGGGAGG - Intronic
1200088960 X:153625581-153625603 CCAGACTGGGAGGGGGTGGCCGG - Intergenic