ID: 1122861616

View in Genome Browser
Species Human (GRCh38)
Location 14:104585080-104585102
Sequence GCCCTTGGGGGCAGGGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 353}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122861601_1122861616 5 Left 1122861601 14:104585052-104585074 CCCCTCACTCTCACCCTCCCCCT 0: 1
1: 0
2: 131
3: 904
4: 5606
Right 1122861616 14:104585080-104585102 GCCCTTGGGGGCAGGGTCCTTGG 0: 1
1: 0
2: 4
3: 34
4: 353
1122861599_1122861616 23 Left 1122861599 14:104585034-104585056 CCTTGAGGACCATGTAGGCCCCT 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1122861616 14:104585080-104585102 GCCCTTGGGGGCAGGGTCCTTGG 0: 1
1: 0
2: 4
3: 34
4: 353
1122861606_1122861616 -9 Left 1122861606 14:104585066-104585088 CCTCCCCCTTCTCAGCCCTTGGG 0: 1
1: 0
2: 7
3: 66
4: 545
Right 1122861616 14:104585080-104585102 GCCCTTGGGGGCAGGGTCCTTGG 0: 1
1: 0
2: 4
3: 34
4: 353
1122861604_1122861616 -8 Left 1122861604 14:104585065-104585087 CCCTCCCCCTTCTCAGCCCTTGG 0: 1
1: 0
2: 8
3: 87
4: 694
Right 1122861616 14:104585080-104585102 GCCCTTGGGGGCAGGGTCCTTGG 0: 1
1: 0
2: 4
3: 34
4: 353
1122861600_1122861616 14 Left 1122861600 14:104585043-104585065 CCATGTAGGCCCCTCACTCTCAC 0: 1
1: 0
2: 0
3: 28
4: 168
Right 1122861616 14:104585080-104585102 GCCCTTGGGGGCAGGGTCCTTGG 0: 1
1: 0
2: 4
3: 34
4: 353
1122861603_1122861616 3 Left 1122861603 14:104585054-104585076 CCTCACTCTCACCCTCCCCCTTC 0: 1
1: 1
2: 24
3: 333
4: 3200
Right 1122861616 14:104585080-104585102 GCCCTTGGGGGCAGGGTCCTTGG 0: 1
1: 0
2: 4
3: 34
4: 353
1122861602_1122861616 4 Left 1122861602 14:104585053-104585075 CCCTCACTCTCACCCTCCCCCTT 0: 1
1: 1
2: 23
3: 355
4: 3125
Right 1122861616 14:104585080-104585102 GCCCTTGGGGGCAGGGTCCTTGG 0: 1
1: 0
2: 4
3: 34
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122861616 Original CRISPR GCCCTTGGGGGCAGGGTCCT TGG Intronic