ID: 1122861898

View in Genome Browser
Species Human (GRCh38)
Location 14:104586536-104586558
Sequence GAGAGGGTAAGGCGGGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122861882_1122861898 24 Left 1122861882 14:104586489-104586511 CCAGAAAGAATGAGGAGGCCGCG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1122861898 14:104586536-104586558 GAGAGGGTAAGGCGGGCCGCTGG 0: 1
1: 0
2: 2
3: 3
4: 182
1122861892_1122861898 -5 Left 1122861892 14:104586518-104586540 CCGCGGGTGTGCAGGGCAGAGAG 0: 1
1: 0
2: 3
3: 46
4: 360
Right 1122861898 14:104586536-104586558 GAGAGGGTAAGGCGGGCCGCTGG 0: 1
1: 0
2: 2
3: 3
4: 182
1122861888_1122861898 6 Left 1122861888 14:104586507-104586529 CCGCGTGGGGCCCGCGGGTGTGC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1122861898 14:104586536-104586558 GAGAGGGTAAGGCGGGCCGCTGG 0: 1
1: 0
2: 2
3: 3
4: 182
1122861891_1122861898 -4 Left 1122861891 14:104586517-104586539 CCCGCGGGTGTGCAGGGCAGAGA 0: 1
1: 0
2: 1
3: 37
4: 295
Right 1122861898 14:104586536-104586558 GAGAGGGTAAGGCGGGCCGCTGG 0: 1
1: 0
2: 2
3: 3
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122861898 Original CRISPR GAGAGGGTAAGGCGGGCCGC TGG Exonic
901877385 1:12174721-12174743 GAGGGGGTAGGGAGGGCAGCTGG - Intronic
902381912 1:16056699-16056721 GAGAGGGGCAGGCTGGCCACTGG - Intronic
903163073 1:21503090-21503112 GGGAGGCCAAGGCGGGCGGCTGG + Intergenic
904286616 1:29456797-29456819 GAGAGGATAAGGGGGGTCGGAGG + Intergenic
904604821 1:31692537-31692559 GGGAGGGTAAGGCTGGGCCCTGG + Intronic
904704680 1:32380935-32380957 GAGAAGGCAAGGGGGGCAGCAGG + Intronic
906341731 1:44986720-44986742 GAGGAGGGAAGGCGGGCCGGAGG + Intronic
906503213 1:46357420-46357442 GAGAGGCCAAGGCGGGCGGATGG - Intronic
907797184 1:57729394-57729416 GAGAGGATGTGGCGGGCAGCGGG - Intronic
913665890 1:121048689-121048711 GAGGGGGCAAGGCGGGGTGCGGG - Intergenic
914017288 1:143831965-143831987 GAGGGGGCAAGGCGGGGTGCGGG - Intergenic
914374508 1:147061647-147061669 GAGAGGCCAAGGCAGGCGGCTGG - Intergenic
915310832 1:155005107-155005129 GGGAGGGTGCGGCGGGCAGCGGG + Intronic
915523544 1:156462777-156462799 GGGAGGCCAAGGCGGGCCTCGGG - Intergenic
915911378 1:159917757-159917779 GAGAGGGTGGGGCTGGCTGCTGG - Intergenic
918004785 1:180531428-180531450 GGGAGGCTGAGGCGGGCAGCTGG - Intergenic
920500084 1:206480268-206480290 GAGAGGGGGAGGCGGGCTGGAGG + Intronic
923095305 1:230770739-230770761 GAGTGGGCAAGGCAGGCTGCTGG - Intronic
1067079062 10:43203450-43203472 GGGAGGGTGAGGCAGGCCCCCGG + Intronic
1067131145 10:43566523-43566545 GGGAGGCTAAGGCGGGCAGATGG - Intronic
1067145267 10:43689542-43689564 GAGAGGGTACGGAGGGCATCAGG + Intergenic
1071669873 10:87598357-87598379 GGGAGGCTAAGGCGGGCAGATGG + Intergenic
1072967904 10:99990311-99990333 GAGAGGCTAAGGTGGGCAGATGG + Intronic
1073047552 10:100649593-100649615 GAGAGGGAAAGACGGGGAGCTGG + Intergenic
1074880891 10:117657341-117657363 GAGAGGGTCAGGCTGCCCTCAGG - Intergenic
1075445100 10:122507603-122507625 GAAAGAGTAAGGCAGGCCGGAGG + Intronic
1075519616 10:123135995-123136017 GAGCGGGACAGGCGGGCGGCGGG - Exonic
1076218973 10:128717895-128717917 GAGAGGGTCAGGCAGGAAGCAGG + Intergenic
1077223380 11:1427109-1427131 GAGAGGGGATGGGGGGCTGCAGG - Intronic
1077271889 11:1685343-1685365 CAGAGGGGAAGGCGGGCAGGTGG - Intergenic
1081525516 11:43925056-43925078 GAGAGGGAAAGGAGGACAGCTGG + Intergenic
1083293252 11:61701378-61701400 CAGAGGGAGAGGCGGGCAGCAGG - Intronic
1083657107 11:64234917-64234939 GAGAGGGCACGGCGGGCGGGCGG - Intronic
1083970447 11:66070851-66070873 GGGAGGGTGCGGCGGGGCGCCGG + Intronic
1087214649 11:95482181-95482203 GAGAGGCCAAGGCAGGCGGCTGG - Intergenic
1090207534 11:124894141-124894163 GAGAGAGGAAGGCGGGATGCAGG + Intronic
1091730572 12:2877277-2877299 GGGCTGGTAAGGCGGACCGCAGG + Exonic
1091747163 12:2999791-2999813 GAGCGGGGAAGGCGGGGAGCAGG - Intronic
1096839081 12:54370027-54370049 GAGAGGGAAAGGCAGGGGGCGGG + Exonic
1101443704 12:104722240-104722262 GGGAGGCTAAGGCGGGCAGATGG - Intronic
1101479653 12:105084605-105084627 GGTAGGGTGGGGCGGGCCGCGGG - Intergenic
1102370744 12:112381317-112381339 GAGAGTGCATGGAGGGCCGCTGG + Intronic
1103892507 12:124250411-124250433 GGGAGGGTGTGGCTGGCCGCAGG + Intronic
1103958532 12:124593219-124593241 GAGAGGGAAAGGCGGGTGGGTGG - Intergenic
1106392810 13:29351852-29351874 GAGAGGCCAAGGCGGGACGATGG - Intronic
1108046194 13:46387051-46387073 GAAAGGGAAGGGAGGGCCGCGGG - Intronic
1112070650 13:95846057-95846079 GGGAGGGCAAGGCAGGCGGCTGG + Intronic
1112077376 13:95928827-95928849 GGGAGGGCAAGGCAGGCGGCTGG + Intronic
1112084662 13:96017347-96017369 AAGAGAGTAAGGGGGGCCCCTGG - Intronic
1112438604 13:99408952-99408974 GAGAGCGTCATGCGGGCCACTGG + Intergenic
1113792586 13:113037046-113037068 GAGATGGACAGGAGGGCCGCTGG - Intronic
1114523224 14:23351923-23351945 GAGGCGGCCAGGCGGGCCGCGGG - Intronic
1114663553 14:24366202-24366224 GAGAGGGGAAGGCGGTTGGCTGG + Intronic
1114696424 14:24631328-24631350 CAGAGGGCAGGGCAGGCCGCTGG + Intronic
1122411523 14:101528380-101528402 GAGAAGGTAAGGGGGGACGGGGG + Intergenic
1122861898 14:104586536-104586558 GAGAGGGTAAGGCGGGCCGCTGG + Exonic
1126402960 15:48293146-48293168 GGGAGGATAAGGCGGGCAGATGG - Intronic
1127606605 15:60592773-60592795 GCGAGGGGAAGGCGGGCGCCCGG - Intronic
1127824449 15:62690645-62690667 GGGAGGCCAAGGCGGGCAGCTGG + Intronic
1127926184 15:63545728-63545750 GGGAGGCTAAGGCGGGCGGATGG + Intronic
1128543358 15:68551896-68551918 GAGAGGGGAAGGTGGGCCATCGG - Intergenic
1134398733 16:13889434-13889456 GGGAGGCTAAGGCAGGCGGCTGG - Intergenic
1135970866 16:27070965-27070987 GGGAGGCTAAGGCGGGCTGGGGG - Intergenic
1136219965 16:28822807-28822829 GAGTGGGTAAGGAGCGGCGCGGG - Intergenic
1136540271 16:30924544-30924566 GAGAGGGTGAGGCTGGGGGCGGG - Intronic
1138197207 16:55060485-55060507 GAGTGGGTGAGGCAGGCAGCAGG - Intergenic
1141244264 16:82291642-82291664 GGGAGGGTGAGGCGGGCAGATGG - Intergenic
1142292840 16:89200748-89200770 GAGATGGGGAGGCGGGCGGCAGG - Intronic
1142701356 17:1663471-1663493 GGGAGGCTGAGGCGGGCCTCGGG + Intronic
1144934993 17:18890549-18890571 GGGAGGGTAAGGCGGGTGGGTGG - Intronic
1147183999 17:38704096-38704118 GAGAAGGGAAGACGGGCCGGGGG - Intergenic
1148411025 17:47467437-47467459 GGGAGGATGAGGCGGGCCGGAGG - Intergenic
1148507147 17:48136458-48136480 GAGAAGGTCAGGCCGGGCGCAGG - Intronic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151625716 17:75274317-75274339 GAGAGGGTGAGGCTGGAGGCAGG - Intronic
1151660800 17:75516941-75516963 GCGGGGGCGAGGCGGGCCGCGGG + Intronic
1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG + Intergenic
1152685849 17:81693618-81693640 GGGAGGGTGAGGGGGGGCGCCGG - Intronic
1152824244 17:82454064-82454086 GGGAGGCTAAGGCAGGCGGCTGG + Intergenic
1153997394 18:10454412-10454434 GAGAGGGGAAGGAGGGAAGCGGG + Intergenic
1154290057 18:13098812-13098834 GAGAGGCCAAGGCAGGCGGCTGG + Intronic
1155570368 18:27185433-27185455 GAGAAGGCAGGGCGGGCAGCGGG - Intergenic
1157599539 18:48885627-48885649 GGGAGGCTAAGGCGGGCCAGGGG + Intergenic
1157602450 18:48902320-48902342 GAAAGGGGAAGGAGGGCGGCTGG - Intergenic
1159957857 18:74532625-74532647 GAGAGGGTGAGGCTGGGCCCAGG - Intergenic
1160553990 18:79714547-79714569 GAGGGGGTAACGCAGGCCCCTGG + Exonic
1160693692 19:472377-472399 GTGAGGGTAAGGCGGGCGAGTGG - Exonic
1161393517 19:4033209-4033231 CAGGGGGGAAGGCCGGCCGCAGG - Intronic
1161685672 19:5701694-5701716 GGGAGGCTAAGGCAGGCGGCTGG - Intronic
1162954530 19:14090857-14090879 GAGGGAGGAAGGCGGGCGGCGGG - Intronic
1163171796 19:15536560-15536582 GAGAGGGTGAGGCTGGAGGCTGG + Intronic
1165434381 19:35788239-35788261 GAGAGGCTCAGGAGGGCCCCAGG - Exonic
1167002886 19:46756281-46756303 GAGCTGGGAAGGCGGGCGGCTGG + Exonic
927214241 2:20657775-20657797 GAGAGGGTAAGCAGGGCTGCAGG + Intergenic
927685640 2:25168679-25168701 GCCAGGGGAAGGGGGGCCGCGGG + Exonic
928374367 2:30763065-30763087 GAGCAGGTAAGGCTGGCTGCTGG - Exonic
928904757 2:36356770-36356792 GAGAGGGAACGCAGGGCCGCGGG - Intronic
929045460 2:37784770-37784792 GAGAGGGTGAGGCTGCCAGCTGG - Intergenic
929700371 2:44157420-44157442 GGGAGGCTAAGGCGGGCGGGTGG - Intergenic
932125784 2:69144501-69144523 GAGAGTGGATGGCGGGCCTCTGG + Intronic
932502841 2:72199482-72199504 CAGAGGGTAAGGCTGGCTACGGG + Intronic
933426260 2:82115692-82115714 GAGAGGGTGTGGTGGGCAGCAGG - Intergenic
933599606 2:84316159-84316181 GAGAGGGGAAGGGGTGCCCCTGG - Intergenic
933791664 2:85888573-85888595 TAGAGGGTGGGGCGGACCGCCGG - Intronic
933793529 2:85902545-85902567 GAGAGGGAAAGTTGGGCAGCAGG - Intergenic
936063877 2:109316127-109316149 GAGAGGGCAAGGCAGGCTGGAGG + Intronic
937395287 2:121529984-121530006 GGGAGGGTAAGGGCGCCCGCAGG + Intronic
939997186 2:148930912-148930934 GAGAGGGAAAGGCGAGGGGCCGG - Intronic
942112987 2:172700636-172700658 GGGAGGCTAAGGCAGGCGGCTGG + Intergenic
942181694 2:173386549-173386571 GAGAGAGCAGCGCGGGCCGCAGG - Intergenic
944515724 2:200510010-200510032 CCGAGGGTCTGGCGGGCCGCAGG - Exonic
944669569 2:201983889-201983911 GAGAGGGTAAGGGGTGGCGGTGG - Intergenic
947641043 2:231708074-231708096 GGGAGGGGAAGGCGGGGTGCTGG - Intronic
947833388 2:233158033-233158055 GAGAGGGGAAGGAGGGAGGCAGG + Intronic
948446410 2:238036897-238036919 GGAAGGATAAGGTGGGCCGCTGG - Intronic
948542647 2:238701502-238701524 CAGAAGGTGGGGCGGGCCGCAGG - Intergenic
1169509906 20:6252209-6252231 GAGAGGGGAAGGAGGGAGGCAGG + Intergenic
1170513334 20:17102072-17102094 GGGAGGGTGAGGCGGGCAGTTGG + Intergenic
1172337797 20:34132208-34132230 GGGAGGCTAAGGCAGGCGGCTGG - Intergenic
1179968158 21:44818473-44818495 GAGCGGAGAAGGCGGCCCGCGGG + Intronic
1179976811 21:44873166-44873188 GTGAGGCTAAGGGAGGCCGCAGG + Intronic
1180559144 22:16601742-16601764 GCGCGGGGAGGGCGGGCCGCGGG - Intergenic
1184053092 22:42023432-42023454 GGGAGGGCAAGGCGGGCAGATGG - Intronic
950015108 3:9749793-9749815 GAGGGGGAAAGGCGAGCAGCTGG + Intergenic
950183768 3:10932790-10932812 GAGAGGGTGAGGCTGGAGGCAGG + Intronic
950422208 3:12905813-12905835 GGGAGGGGCAGGAGGGCCGCTGG + Intronic
954134364 3:48575322-48575344 GAGAGGGTGAGGCTGGGGGCTGG - Exonic
959565260 3:107826654-107826676 GACAGGGGAAGGCAGGCCACGGG - Intergenic
962084278 3:132173950-132173972 GAGAGGGGCAGGCTGGCCCCTGG - Intronic
968875112 4:3262582-3262604 TAGAAGGTAAGGCGGTCCCCAGG - Intronic
968925673 4:3546209-3546231 GAGAGGCTGAGGCGGGCAGATGG + Intergenic
969096443 4:4736133-4736155 GGGAGGGTTAGGCAGGCTGCAGG + Intergenic
974021319 4:56693920-56693942 GGGAGGCCAAGGCGGGCGGCTGG + Intergenic
974047351 4:56908622-56908644 GAGGGGGCCAGGAGGGCCGCGGG - Intronic
977229180 4:94431585-94431607 GAGAGGCTAAGGTGGGCAGATGG - Intergenic
985736335 5:1585773-1585795 GGGAGGCCAAGGCAGGCCGCTGG - Intergenic
985997017 5:3602694-3602716 GAGGGGGAAAGTCGGGGCGCTGG + Intergenic
986680956 5:10232520-10232542 ATGAGAGTAAAGCGGGCCGCTGG + Intronic
989021611 5:37013840-37013862 GAGAGGCCAAGGCAGGCTGCTGG + Intronic
989146915 5:38258476-38258498 GGGAGGGAAGGGCTGGCCGCGGG - Exonic
992645793 5:78809764-78809786 GAGAGGGCAAGGCTGGCTCCAGG - Intronic
997233013 5:132257549-132257571 GGGAGGGTCGGGCTGGCCGCGGG + Intronic
999262063 5:150244536-150244558 GAGACGGGAAGGAGGACCGCAGG + Intronic
1001493041 5:172168991-172169013 GAGAGGGAATGGCGGGACCCTGG - Intronic
1002422497 5:179155884-179155906 GAGAAGGGAAGGAGGGCCACTGG + Intronic
1002529484 5:179835318-179835340 GGGAGGCTAAGGCAGGCAGCTGG + Intronic
1003139435 6:3457699-3457721 GAGTGGGTGCGGCGGGTCGCAGG - Intergenic
1006332913 6:33405125-33405147 GAGAGGCTAAGGCGGGTTGGAGG - Exonic
1007547315 6:42704319-42704341 TAGAGGGTAAGGAGAGCCTCCGG - Intronic
1007665398 6:43510298-43510320 GAGAGCCTGAGGCGGGCGGCTGG + Exonic
1008965794 6:57311661-57311683 GGGAGGCCAAGGCAGGCCGCTGG + Intergenic
1011054846 6:83193671-83193693 GAGAGGGGGATGCGGGCCGCCGG - Intronic
1019404870 7:877822-877844 GAGAGAGAAAGGCGGGGGGCCGG - Intronic
1019683760 7:2368387-2368409 GAGAGGCTGAGGCGGGCAGGCGG - Intronic
1023435313 7:40135271-40135293 GAGCGGGGCAGGCCGGCCGCAGG - Intronic
1025265016 7:57449661-57449683 GAGAGGGGAGGGCGGGGGGCGGG - Intergenic
1026822144 7:73557156-73557178 AAGAGGGGAGGGCGGGCCCCGGG + Intronic
1027894306 7:84021510-84021532 GAGATGGTAAGGCCGGAGGCAGG - Intronic
1029525611 7:101092151-101092173 GGGAGGCCAAGGCGGGCGGCTGG - Intergenic
1032257776 7:130311013-130311035 AGGAGGGTCAGGCGGGCCCCAGG - Intronic
1032710851 7:134458951-134458973 GAGAGTGTGAGGCGAGCCCCGGG + Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036149264 8:6283050-6283072 GAGAGGGTGAGGCAGGCTCCAGG - Intergenic
1036405396 8:8450388-8450410 GAGAGGCCAAGGCGGGCGGATGG + Intergenic
1036692403 8:10952088-10952110 GAGAGGGGCAGGAGGGCTGCAGG - Intronic
1040043613 8:42940115-42940137 GGGAGGCCAAGGCAGGCCGCCGG + Intronic
1040471352 8:47738013-47738035 GGGCGGGCAAGCCGGGCCGCGGG - Exonic
1041513685 8:58676881-58676903 GGGAGGCTAAGGCAGGCTGCTGG + Intergenic
1043547816 8:81335092-81335114 GAGAGAGGAAGGGGGGCAGCAGG + Intergenic
1043986121 8:86694932-86694954 GGGAGGCTAAGGCAGGCGGCTGG + Intronic
1046871359 8:119208599-119208621 GAGATTGTAAGTGGGGCCGCCGG + Exonic
1048409407 8:134156545-134156567 GAGTGGGTAAGGCGTGCCTAAGG - Intergenic
1049680525 8:143915961-143915983 GAGGGGGTGAGGCGGCCAGCAGG + Exonic
1055644559 9:78350531-78350553 GGGAGGCTGAGGCGGGCAGCTGG - Intergenic
1056006311 9:82275192-82275214 GAGAGGGTAAGGCAGGGAACAGG + Intergenic
1056166702 9:83947876-83947898 GAGAGGCCAAGGCAGGCGGCTGG - Intronic
1058152230 9:101476047-101476069 GTGAGGGTCCGGCGGGCCGCAGG + Exonic
1058687329 9:107489934-107489956 GGGAGGGGAAGGAGGGGCGCGGG + Intronic
1060935019 9:127509750-127509772 GAGAGGGAAGGGCGGGCTTCAGG - Intronic
1061261382 9:129482669-129482691 GAGGGGGAGAGGCGGGCGGCGGG + Intergenic
1061918490 9:133769520-133769542 GAGAACGTGAGGCGGGCAGCAGG + Intronic
1185949501 X:4415880-4415902 GAGAGGTTGAGACGGGCCGATGG - Intergenic
1190597365 X:52062719-52062741 GAGGGGGTGAGGCGGGCCGCGGG - Intronic
1190611459 X:52191354-52191376 GAGGGGGTGAGGCGGGCCGCGGG + Intronic
1192495998 X:71616960-71616982 GTGAGGGTCACGCGGGCCGGGGG + Exonic
1192848062 X:74925762-74925784 GAGAGGGTAAGGAGAGCGGGAGG - Intergenic