ID: 1122863824

View in Genome Browser
Species Human (GRCh38)
Location 14:104594628-104594650
Sequence CACCAAGTCTCCTAGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122863807_1122863824 28 Left 1122863807 14:104594577-104594599 CCTGCATTTCAGCAAATAGCGTC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1122863824 14:104594628-104594650 CACCAAGTCTCCTAGGGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1122863813_1122863824 5 Left 1122863813 14:104594600-104594622 CCTCAGAGTGGGGGCCACCATCG 0: 1
1: 0
2: 2
3: 16
4: 120
Right 1122863824 14:104594628-104594650 CACCAAGTCTCCTAGGGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1122863812_1122863824 6 Left 1122863812 14:104594599-104594621 CCCTCAGAGTGGGGGCCACCATC 0: 1
1: 0
2: 2
3: 18
4: 154
Right 1122863824 14:104594628-104594650 CACCAAGTCTCCTAGGGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1122863814_1122863824 -9 Left 1122863814 14:104594614-104594636 CCACCATCGCCCTCCACCAAGTC 0: 1
1: 0
2: 1
3: 27
4: 269
Right 1122863824 14:104594628-104594650 CACCAAGTCTCCTAGGGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122863824 Original CRISPR CACCAAGTCTCCTAGGGGGC GGG Intronic
901068558 1:6506189-6506211 CACCCAGCCTCCGAGGGCGCGGG - Intronic
901093133 1:6656783-6656805 CTCCCAGTCTCCTAGGTGACTGG - Intronic
902374243 1:16022841-16022863 CCCAAAGTCTCCTGGGTGGCAGG + Intronic
902379194 1:16044718-16044740 CCCAAAGTCTCCTGGGTGGCAGG + Intronic
902768256 1:18630978-18631000 CCCCGGGTCTCCTAGGGGACGGG + Intergenic
905522819 1:38613558-38613580 AACCAAGTCTTCTAAGAGGCAGG + Intergenic
909183086 1:72449844-72449866 CACCATGCCACCTAGGGGTCTGG + Intergenic
912369436 1:109162156-109162178 CACCAAATCTCATAAGGGTCTGG - Intronic
916853639 1:168727976-168727998 CTCCAAGCCTCCTAGAGTGCTGG + Intronic
920498108 1:206469740-206469762 CATCAAATGTCCTAGGAGGCTGG - Intergenic
921163075 1:212486607-212486629 CACGTGGTCTGCTAGGGGGCAGG + Intergenic
922457369 1:225785879-225785901 CACCATGTCGCCCAGGCGGCTGG + Intronic
1062901616 10:1150940-1150962 CACCAGGTGTCCTAGAGGGAGGG + Intergenic
1067166710 10:43871137-43871159 CCCCAAGTCTCCAGCGGGGCCGG - Intergenic
1067926469 10:50513402-50513424 CTCAAAGACTCCTAGGGGGAAGG - Intronic
1067964544 10:50895173-50895195 TACCATGACTCCTAGAGGGCAGG + Intergenic
1071574766 10:86716957-86716979 CACCCACTCTCCCAGGGAGCTGG + Intronic
1081933728 11:46890204-46890226 TACCAAGGCTCCTGGGGGGCAGG + Intronic
1084222907 11:67695546-67695568 CACCCAGTCTCCTTCGGGTCGGG - Intergenic
1085017857 11:73187071-73187093 CACCCAGTATACTAGGTGGCTGG - Intergenic
1085226815 11:74929068-74929090 CACCCTGTCTCCTAAAGGGCAGG + Intronic
1085445565 11:76598490-76598512 CACAAAGTCTCCTAGCAGGATGG - Intergenic
1085582117 11:77661548-77661570 CACCAATTCTGCTAAAGGGCAGG + Exonic
1088560993 11:111116177-111116199 AACCAAGTCACCCTGGGGGCTGG - Intergenic
1089860204 11:121583386-121583408 CACCAACTGTCCAAGGGGGTGGG - Intronic
1096748583 12:53744530-53744552 CTCCAAGGATCCAAGGGGGCAGG - Intergenic
1102812047 12:115832840-115832862 CCCCAAGTCTCCTGGGGGCCAGG + Intergenic
1105344194 13:19559443-19559465 CACCCAGCCTCCTCGGGGGTAGG - Intergenic
1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG + Intronic
1113931602 13:113971749-113971771 CACCAAGTCTGCGAGGGGTGAGG + Intergenic
1122863824 14:104594628-104594650 CACCAAGTCTCCTAGGGGGCGGG + Intronic
1125578128 15:40768642-40768664 CACCAGGGCTCCTGGAGGGCAGG + Intronic
1129271370 15:74421000-74421022 GCCCAGGTCTCCGAGGGGGCCGG + Intronic
1132346772 15:101113367-101113389 CACCGTGTGTCCTAGGGGGCAGG - Intergenic
1133067736 16:3221285-3221307 CACCCAGTGTCCCAGAGGGCAGG - Intergenic
1133166956 16:3954619-3954641 CACCAAGAAGCCAAGGGGGCCGG + Intronic
1136467625 16:30455905-30455927 CATCAGGTCTCCTGGGCGGCTGG - Intergenic
1142354580 16:89596561-89596583 CACCCAGGCTTCTCGGGGGCAGG - Exonic
1145762673 17:27435071-27435093 CTCCAAGTCTCCTAGCAGCCAGG - Intergenic
1148558301 17:48591652-48591674 GCCCAAGTCTCCTAGGGGCTTGG - Exonic
1155780813 18:29832163-29832185 AACCAAGTATGCTATGGGGCTGG + Intergenic
1160559883 18:79749525-79749547 CACCAAGTCCAGGAGGGGGCGGG - Intronic
1163434917 19:17289715-17289737 AACCAGGTCCCCCAGGGGGCGGG + Intergenic
1163817774 19:19477461-19477483 CGCCAAGTCTCCTGGAGGCCTGG - Intronic
1165795359 19:38516192-38516214 CACCAAGTCTCCGCGGGAGCGGG + Exonic
1167039967 19:47018135-47018157 CACCTAGCCTCCTAAGTGGCTGG - Intergenic
1168717126 19:58535995-58536017 CAACAGGTCTCCTATGTGGCTGG + Intronic
1202675211 1_KI270710v1_random:38087-38109 CATCTATTCTCCTAGGGGTCTGG - Intergenic
925114858 2:1369961-1369983 CACCACCTCTCCTGGGGTGCAGG + Intergenic
925617328 2:5756104-5756126 CACCAGGGCTCCAAGGTGGCAGG - Intergenic
926453831 2:13040221-13040243 CCCCGAGTTTCCCAGGGGGCAGG + Intergenic
931380371 2:61747382-61747404 CAACAAATCTCCATGGGGGCAGG + Intergenic
932128969 2:69170181-69170203 CAGCAAGCCTCTTAGGAGGCAGG + Intronic
936514896 2:113175163-113175185 GACAAAGACCCCTAGGGGGCTGG - Intronic
937251043 2:120524005-120524027 CACCCAGTCTCAGAGGAGGCAGG + Intergenic
938905867 2:135835694-135835716 CTTCAAGTCCCCTAGGAGGCAGG + Intronic
940704401 2:157085706-157085728 CAGCAATTCTCCAAGAGGGCTGG + Intergenic
941902250 2:170689540-170689562 CACCTAGTCTCCTACAAGGCAGG + Intergenic
1168965393 20:1895240-1895262 CTCCATTTCTCCTGGGGGGCGGG + Intronic
1170931687 20:20774357-20774379 CACCATGTCTCCAAGGTGGCAGG - Intergenic
1171343119 20:24445911-24445933 CACAAAGTCTTCTGGAGGGCAGG - Intergenic
1172177849 20:32983443-32983465 GACCAAGGCTCCTAGAGGGTAGG + Intergenic
1174483334 20:50845892-50845914 CACCAAGTCACCTGGGCAGCGGG - Intronic
1179017179 21:37604096-37604118 CTCCAAGCCTCCTTGGGGGATGG + Intergenic
1180950275 22:19717673-19717695 CCCTAAGCCTCCTAGGGGACAGG + Intronic
1183829132 22:40408762-40408784 CACCAAAGCTCCTGGGGTGCCGG - Intronic
1185149357 22:49155178-49155200 CCCCAAGTCCCCTCGGGGACAGG + Intergenic
950279686 3:11696168-11696190 CACCAAGACTCCAAGGGGAATGG + Intronic
954903714 3:54042048-54042070 CACCATGTGTCCTAGAGGGCAGG - Intergenic
954918325 3:54167517-54167539 CACCAAGACTCCACGGGAGCTGG - Intronic
955154420 3:56402544-56402566 CACTAGCCCTCCTAGGGGGCAGG - Intronic
956766985 3:72492266-72492288 CACCAAATTTCCCAGGGGCCTGG + Intergenic
958905240 3:99934880-99934902 CACCAATTCTCTTTGGAGGCTGG + Intronic
961447296 3:126986850-126986872 CTCCAAGTCTACCAGGGAGCTGG - Intergenic
961483327 3:127197656-127197678 CAGCAAATCTACTAGAGGGCGGG - Exonic
962871451 3:139496969-139496991 CACCAAATGTCCTAGAAGGCAGG - Intergenic
966356775 3:179088634-179088656 CACAAAGTCTACTATGGGTCTGG - Intergenic
967092040 3:186143070-186143092 CTCCAAGTCTCCCAGGGGTCAGG - Intronic
968830466 4:2930974-2930996 CACCCAGTCCCCGAGGGGGCTGG + Intronic
968888452 4:3351777-3351799 CACCAAGTCTTCTAGGACTCTGG - Intronic
970468664 4:16353167-16353189 CATCAAGTCTCCTAAGGGATGGG - Intergenic
973200683 4:47498381-47498403 TAGCAAATGTCCTAGGGGGCTGG + Intronic
978807777 4:112818561-112818583 CACCAAGTCCACTCTGGGGCTGG - Intronic
982360422 4:154513434-154513456 CACTATGTTTCCTAGGAGGCTGG - Intergenic
985844660 5:2335259-2335281 CAGCAAGTGTCCTCGGGTGCTGG - Intergenic
986543235 5:8869361-8869383 CACAAAGTCTCCTACCTGGCTGG - Intergenic
991639779 5:68740754-68740776 TACCAAGTCTCCTAGGTAACTGG + Intergenic
993094943 5:83471315-83471337 CCCCCAGGCTCTTAGGGGGCAGG - Intergenic
994236567 5:97369612-97369634 GATCATGTCTCCTGGGGGGCCGG - Intergenic
998727900 5:145039597-145039619 CAACATGTCTCCTCAGGGGCTGG + Intergenic
1001593991 5:172886122-172886144 CACCAAGTGTCGATGGGGGCCGG - Intronic
1002270890 5:178071145-178071167 CACCAAGTCTCCTGGGAAGAGGG - Intergenic
1002322607 5:178384622-178384644 AACCAAGGCTCAGAGGGGGCAGG + Intronic
1002772399 6:301142-301164 CACCAAGACTCCCTGGGGCCAGG + Intronic
1019448990 7:1086730-1086752 CACCAGCTCTCCTGGGGGGGAGG + Intronic
1022230743 7:28410046-28410068 CGCCGGGTCACCTAGGGGGCGGG + Intronic
1023573435 7:41596414-41596436 TAACAAGTCTCACAGGGGGCTGG + Intergenic
1024369461 7:48563601-48563623 CACCAAGTCTCATAGAGGAAGGG + Intronic
1029745728 7:102514802-102514824 CACCAAGTGGCCTTGGGGACTGG - Intronic
1029763666 7:102613781-102613803 CACCAAGTGGCCTTGGGGACTGG - Intronic
1031008462 7:116499769-116499791 CACCAAGGCTGCGATGGGGCTGG + Exonic
1035099281 7:156382941-156382963 CATCGAGTCTCCCATGGGGCAGG - Intergenic
1036004745 8:4648957-4648979 CACCTAGTATCCTAGGGCCCTGG + Intronic
1036395086 8:8362571-8362593 CACCCATTCTCCTCTGGGGCAGG - Intronic
1043424531 8:80135427-80135449 CTCTAACTCTCCTGGGGGGCAGG - Intronic
1049849065 8:144821089-144821111 CCCCTAGACTCCTTGGGGGCAGG - Intergenic
1062652203 9:137583734-137583756 AACCAAGTCTCCTCAGGGTCTGG - Intronic
1062729856 9:138102827-138102849 CACACAGCCTCCTGGGGGGCGGG - Intronic
1187319610 X:18227889-18227911 CACTCAGCCTCCTGGGGGGCGGG + Intergenic
1195658942 X:107359736-107359758 CACCAAGTCCACTAGGGAGTAGG - Intergenic
1201172961 Y:11287871-11287893 CATCTATTCTCCTAGGGGTCTGG - Intergenic