ID: 1122864456

View in Genome Browser
Species Human (GRCh38)
Location 14:104597246-104597268
Sequence CCCCCACCAGCAGCACCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 0, 2: 10, 3: 75, 4: 665}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122864449_1122864456 23 Left 1122864449 14:104597200-104597222 CCAGAAACAGGAGGGGCAGGCTC 0: 2
1: 0
2: 2
3: 27
4: 230
Right 1122864456 14:104597246-104597268 CCCCCACCAGCAGCACCCCCCGG 0: 1
1: 0
2: 10
3: 75
4: 665
1122864453_1122864456 -8 Left 1122864453 14:104597231-104597253 CCATCTCCTGGGCAACCCCCACC 0: 1
1: 0
2: 4
3: 57
4: 477
Right 1122864456 14:104597246-104597268 CCCCCACCAGCAGCACCCCCCGG 0: 1
1: 0
2: 10
3: 75
4: 665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122864456 Original CRISPR CCCCCACCAGCAGCACCCCC CGG Intronic
900082665 1:870067-870089 CCCGCAACAGCAGCCCCACCCGG + Intergenic
900093222 1:929647-929669 CGTCCACCAGCACCAGCCCCAGG + Intronic
900104536 1:976703-976725 CCCCCACCCCCACCAACCCCGGG + Intronic
900111040 1:1005787-1005809 CCCCCCGCAGCAGTGCCCCCAGG + Intergenic
900119615 1:1042909-1042931 CCCTGACCACCAGCATCCCCAGG - Intronic
900124518 1:1063483-1063505 CACTCCCCAGCTGCACCCCCAGG - Intergenic
900151263 1:1180245-1180267 CCCCCAGCAGGAGCCCCTCCAGG - Exonic
900320173 1:2079641-2079663 CCGCCATCAGCAGCAGCCGCGGG - Intronic
900375668 1:2353479-2353501 GACCCACCAGCATCACCCCGAGG - Intronic
900458616 1:2789615-2789637 CCACCAGCAGCAGCCCCCGCTGG + Exonic
900550618 1:3252604-3252626 TGCCCACCAGCCCCACCCCCAGG - Intronic
900656789 1:3762564-3762586 GCCCCTCCTGCAGCACCCCAGGG - Intronic
900915958 1:5638818-5638840 TCCCCACCCCCAGCACCTCCTGG + Intergenic
901866981 1:12112786-12112808 CCAGCGCCAGCAGCACCCCGAGG + Intronic
902232565 1:15037030-15037052 CCCCCAACCCCATCACCCCCTGG + Intronic
902349972 1:15847400-15847422 GCCCCTCCAGCGGCAACCCCAGG - Intergenic
902392790 1:16115958-16115980 CCCCCACCAGCTGGGCCTCCAGG - Intergenic
902535770 1:17118734-17118756 CAACCACCAGCAGCCCCCACAGG + Intronic
903445321 1:23419022-23419044 CCCCCACCAGCTCTCCCCCCAGG + Intronic
905066903 1:35192278-35192300 CTACCACCAGCAGCATCACCAGG - Exonic
906209285 1:44003154-44003176 CCTCCACCTGCTGCAGCCCCTGG + Intronic
906318065 1:44800690-44800712 CCTCCACCATCACCACCCCGCGG - Intronic
906615104 1:47228663-47228685 CCCACACCAGCACAACACCCTGG + Intronic
906734833 1:48115531-48115553 CCACCACCAGCAGCAGCCCATGG - Intergenic
907018023 1:51036107-51036129 CCCCAACCAGCAGAACCGGCAGG - Intergenic
907372879 1:54014385-54014407 CCCCTATCACCACCACCCCCGGG - Intronic
908431349 1:64061603-64061625 CCAGCAGCACCAGCACCCCCTGG - Intronic
909649367 1:77956604-77956626 CCACCACCAGCAGCCCCTGCAGG - Exonic
912473992 1:109924244-109924266 CCCCCACCTGCACCCCCGCCAGG - Intronic
912831110 1:112955408-112955430 CCCCCGTCAGCACCACTCCCAGG + Exonic
914678967 1:149925904-149925926 CCCCCATCGGCAGGAACCCCAGG - Exonic
915120486 1:153627283-153627305 GCCCCACCCGCCGCACCCCAGGG - Intronic
915592059 1:156876224-156876246 CCCAGGCCAGCAGTACCCCCCGG - Intronic
915967841 1:160327460-160327482 CCCCCCCCAGCCCCGCCCCCCGG - Intronic
917905792 1:179586442-179586464 CCCCTACCTGCAGCGCCCCACGG - Intergenic
918340842 1:183566919-183566941 CCACCCTCAGCAGCAGCCCCAGG - Exonic
918596647 1:186301884-186301906 CTTCCAACAGCAGAACCCCCAGG + Intronic
920054105 1:203180417-203180439 CCCACACCACCAGCAGCCCTGGG - Intronic
920339959 1:205269528-205269550 CGCCCACCTGAAGGACCCCCTGG + Exonic
921055821 1:211541709-211541731 CTCCCACCAGAAGCAACCCATGG + Intergenic
921129632 1:212208635-212208657 CCACCACCACCACCACCACCAGG - Intergenic
921830652 1:219724484-219724506 CCCCCACCACCTGCACTTCCAGG + Intronic
922516310 1:226210720-226210742 TCCCCACCGGCATCACCCTCTGG + Intergenic
923119694 1:230978731-230978753 CCCCCAGCAGCAGCAGCAGCAGG + Exonic
923460505 1:234205895-234205917 CCACCACCCCCTGCACCCCCAGG - Intronic
923680025 1:236111658-236111680 CCCCTACCAGCACCCCCCACAGG + Intergenic
924037133 1:239949207-239949229 CCCCCAACAGCAGCCTGCCCGGG + Intergenic
924414106 1:243840340-243840362 CCCCCACCCCCAGCAGGCCCTGG - Intronic
1062963091 10:1588495-1588517 CTCCCAACAGCAGCACCGTCTGG - Intronic
1063001960 10:1932783-1932805 CCCAGACCAGCAGCACTTCCAGG - Intergenic
1063484892 10:6410590-6410612 TGCCCACCACCAACACCCCCAGG - Intergenic
1065023060 10:21516766-21516788 CCACCACCACCACCACCACCGGG - Exonic
1065326282 10:24553187-24553209 CCCCCACCCCCAGCACGACCTGG - Intergenic
1065639971 10:27771439-27771461 CCCCCACCACCACCACGCCGTGG + Intergenic
1065835101 10:29650016-29650038 CCCTCACCAGATGCAGCCCCTGG + Intronic
1066117991 10:32257143-32257165 CCCCCTCCAGCAGAAGTCCCTGG - Intergenic
1067296951 10:44980055-44980077 CCCCCACCTGCAGCACAGGCAGG - Intronic
1067732188 10:48820419-48820441 CCACCTCCAGGAGCACCTCCAGG - Exonic
1067851297 10:49756318-49756340 CCCCCACCAGTTGCTCCTCCTGG - Intronic
1070104017 10:73414712-73414734 CCCCGAACAGCAGCATCACCTGG + Intergenic
1070257858 10:74826371-74826393 CCCCCTCCGGCACCACCCCGGGG - Intronic
1070340743 10:75495836-75495858 CCACCACAAGCAGCACCACCTGG - Intronic
1070439781 10:76432224-76432246 ACCACACCAGCAGCACCCCCAGG - Intronic
1070657832 10:78283368-78283390 CTCCCACCTGCAGCAGCTCCAGG - Intergenic
1070834986 10:79442515-79442537 CCCCCTCCTGCACCACCCCCAGG - Intronic
1071055280 10:81502903-81502925 CCCCCACCAGGAGCTCGCACTGG - Intergenic
1072629157 10:97133843-97133865 CTCACTCCAGCACCACCCCCAGG + Intronic
1072843077 10:98796394-98796416 CCACCACCATCAGCAGCCCATGG - Intronic
1073097112 10:100986705-100986727 GCCCCACCAACTGCAGCCCCAGG - Intronic
1073204619 10:101762349-101762371 CCCCCACCCCCAGCACCCCAGGG + Intergenic
1073457500 10:103646538-103646560 CTCCCACCCCCAGCACCCACAGG + Intronic
1074156343 10:110803528-110803550 CCACCAGCAGCAGCATCTCCTGG - Intronic
1074465396 10:113677386-113677408 CCCCCACCCGCAACAGGCCCCGG - Intergenic
1074536080 10:114329457-114329479 GACCCACCAGCAGCTGCCCCTGG + Intronic
1075608275 10:123831958-123831980 CCCCCACAACCCCCACCCCCTGG - Intronic
1075931671 10:126302159-126302181 ACCCCACCAACCCCACCCCCAGG + Intronic
1076248507 10:128966379-128966401 CAACCACCAGCAGCCCCCTCAGG - Intergenic
1076286034 10:129297197-129297219 CCCCCTCCTTCAGCACCCCCTGG + Intergenic
1076401784 10:130189796-130189818 CCCTCCCCAGTAGCACCACCTGG - Intergenic
1076472385 10:130728099-130728121 TTCCCTCCAGGAGCACCCCCGGG - Intergenic
1076601670 10:131660752-131660774 CCACGACCAGCAGCAACCTCAGG + Intergenic
1076686426 10:132200304-132200326 CACCGACCACCTGCACCCCCTGG - Intronic
1076850247 10:133088927-133088949 CCCCCAGCTGCAGGACCCCCGGG - Intronic
1076850440 10:133089884-133089906 CCAGCACCAGCAGCACCTCAGGG + Intronic
1076903663 10:133351889-133351911 GCCCCACCACCAGCAGCCCCAGG - Intronic
1077011324 11:380588-380610 CCCCCCGCACCAGCACACCCAGG + Intronic
1077075117 11:697001-697023 CCCCCCCCACCACCACCACCGGG - Intronic
1077117595 11:892270-892292 TGCCCACCAGCACCACCCACAGG + Intronic
1077170635 11:1164468-1164490 CTCCAACCAGGAGCACTCCCGGG + Exonic
1077194449 11:1272300-1272322 CCCCGGCCTGCAGCACCCCAGGG + Intergenic
1077227098 11:1443206-1443228 CCCCAGCCTGCCGCACCCCCAGG + Intronic
1077242356 11:1517298-1517320 CCCCGGCCAGCAGCACTCTCCGG + Intergenic
1077283762 11:1756926-1756948 TCTCCACCATCAGCAACCCCGGG + Intronic
1077507982 11:2940989-2941011 CCCCCAACAGCAGGGCCTCCTGG - Intergenic
1078094112 11:8285989-8286011 CACCCAGAAGCAGCACCCTCAGG + Intergenic
1079009941 11:16819632-16819654 CCACCAGCATCAGCACCACCTGG + Intronic
1079041463 11:17063851-17063873 CCCCAACTACCAGCACCCCCGGG - Intergenic
1079071835 11:17353618-17353640 CCACCACCACCAGCATCCGCGGG - Intronic
1079303159 11:19297426-19297448 TCCCCATCAGCAGCACCACCTGG - Intergenic
1079309217 11:19349649-19349671 CCCCCAACACCAGCACCATCAGG - Intergenic
1080418544 11:32091235-32091257 CCAGCGCCAGCAGCAGCCCCAGG - Exonic
1081611411 11:44565469-44565491 CCCCAACCAGCCTCGCCCCCGGG - Intronic
1081636904 11:44727367-44727389 CCGCGTCCAGCAGCACCCCCGGG - Intronic
1081855440 11:46300405-46300427 CCCAGACCAGCAGCATCACCTGG + Intronic
1083201368 11:61122974-61122996 ACACGACCAGCAGCACCACCAGG - Exonic
1083301020 11:61739672-61739694 CCCCCTGCAGCAGCAGACCCTGG - Intronic
1083429921 11:62609001-62609023 CCGCCACCTCCAGGACCCCCTGG + Exonic
1083741415 11:64713447-64713469 CGTCCACCAGCAGCAGCTCCAGG + Exonic
1083757580 11:64800034-64800056 CCTCCACCAACATCACCCTCGGG + Intronic
1083771418 11:64869820-64869842 CCGCTGCCAGCAGCACCCCCAGG - Intronic
1084040484 11:66539714-66539736 CCCGCAGCAGCAGCATCCCATGG + Exonic
1084662907 11:70557625-70557647 CCCCCACCCACAGCTCCCCCAGG - Intronic
1084668888 11:70593586-70593608 CCCACACCTACAACACCCCCAGG + Intronic
1084891001 11:72237220-72237242 CCCGCACCAGCTGCTGCCCCCGG + Exonic
1085266573 11:75241079-75241101 CCGCCACGAGCAGCAGCCCCTGG - Exonic
1085470748 11:76756359-76756381 CAGCCACCAGCAGCACCGCATGG + Intergenic
1085730271 11:78991866-78991888 CCTCCACCAGCAGCAGCACAGGG - Intronic
1087195461 11:95300187-95300209 TCCCCACTACCTGCACCCCCAGG - Intergenic
1087797964 11:102474055-102474077 CCCCCACCCCCAACACCACCGGG - Intronic
1088687571 11:112297972-112297994 CCAGGACCAGCAGCACCACCTGG - Intergenic
1089216626 11:116838007-116838029 CCCCCACCACCAGCATTCCAGGG + Intergenic
1089479324 11:118791900-118791922 CCCCCACAACCAGCGCCCCCAGG - Intergenic
1089590261 11:119535573-119535595 CCCCGACCACCTGCATCCCCTGG - Intergenic
1089626025 11:119751573-119751595 GCCCCATCAGCAGCGCCTCCAGG - Intergenic
1089809720 11:121121685-121121707 CCCCCACCATCACAACCCTCAGG - Intronic
1089821449 11:121230920-121230942 CCCTCACCAGGAGCAGACCCTGG - Intergenic
1089909314 11:122080150-122080172 CCTACAACAGCAGCAACCCCTGG + Intergenic
1090657927 11:128860012-128860034 CCAGCAGCAGCAGCGCCCCCTGG + Intronic
1090780442 11:130002396-130002418 CCCCCTCCAGCAGGCCCTCCTGG - Intronic
1090931130 11:131299070-131299092 CCAGCAGCAGCAGCACCACCTGG - Intergenic
1091223859 11:133946350-133946372 CCCCCACCAGCTGCCCTCCATGG + Intronic
1091464149 12:669258-669280 CCACCACCAAGAGCATCCCCAGG - Intergenic
1091549951 12:1529988-1530010 CCCCGGCCAGCAGCCCCCTCGGG - Intronic
1091748490 12:3008253-3008275 CCCACACCACCTGCACCCCTTGG - Intronic
1091848661 12:3677818-3677840 CCCCCACCAGGATCTTCCCCAGG + Intronic
1092491882 12:8953049-8953071 CCCCCCCCCGCAAAACCCCCAGG + Intronic
1093893239 12:24548532-24548554 TCCCCACCAGCAGAGTCCCCAGG + Intergenic
1093894677 12:24562725-24562747 CCCGCCCCCGCCGCACCCCCCGG - Intergenic
1095953596 12:47794759-47794781 TCCTCTCCAGCAGCACCCTCAGG - Exonic
1096116896 12:49060250-49060272 CCCCCACCTTCTGCTCCCCCCGG + Intergenic
1096123089 12:49101355-49101377 TCCCCACCATCAGCACTACCCGG + Intronic
1096416515 12:51418987-51419009 CCCCCACCAGCAAAAGCCCAGGG - Intronic
1096812762 12:54182290-54182312 CCCCCAGCAGCTGCACCTGCCGG + Exonic
1097143894 12:56926284-56926306 CCCCCACCACCAGAACCATCAGG + Intronic
1097262771 12:57728767-57728789 CCCCCACCGCCACCAGCCCCAGG - Intronic
1098322233 12:69257833-69257855 TCCCCACCAGGAACAGCCCCTGG - Exonic
1099695382 12:86012813-86012835 CCACCACCACCACCACCACCTGG + Intronic
1100560212 12:95740845-95740867 CCCAGACCAACAGCACCCCTAGG + Intronic
1101989871 12:109476195-109476217 GTCCCACCAGCAGCAACACCTGG - Intronic
1102533157 12:113561652-113561674 CCCCCACCATCACCCCTCCCCGG - Intergenic
1102678445 12:114674173-114674195 CCACCTCCAGCAGCACGTCCTGG - Exonic
1102829477 12:115983459-115983481 ACCCCACCAGCAGCAGCACAGGG - Exonic
1102995451 12:117346605-117346627 CCAGCACCAGCAGCATCACCTGG + Intronic
1103555941 12:121766495-121766517 CTCCCACCAGCAGTAACCCCTGG + Intronic
1103741352 12:123093886-123093908 CCAACACCACCAGAACCCCCTGG + Intronic
1104589092 12:130070084-130070106 CCTCAACCAGCAGCACCCACAGG + Intergenic
1104720016 12:131040037-131040059 ACCCCACCAGCGGCACCCTCAGG + Intronic
1104826217 12:131711296-131711318 CCCCCACCGCCGGCACCGCCTGG - Exonic
1104846878 12:131851351-131851373 CCCGCGCCAGCACCTCCCCCAGG - Exonic
1104948223 12:132426940-132426962 CTCTCCCCTGCAGCACCCCCAGG - Intergenic
1104983555 12:132584559-132584581 CCCCAACCAGCAGAGCCGCCGGG - Exonic
1105571785 13:21610435-21610457 CCCCCATCTGAAGCACTCCCAGG - Intergenic
1105844024 13:24279482-24279504 CTCCCTCCAGCAGCCCCTCCTGG - Intronic
1106254924 13:28013560-28013582 CCCCCATCAACACCACCACCTGG - Intronic
1106402121 13:29441197-29441219 CCCCCACCAGGAGAAGCCCAGGG + Intronic
1106709030 13:32311572-32311594 CCCTCAGCAGCTGCTCCCCCTGG - Exonic
1107018637 13:35729722-35729744 CTCCCACAAGCAGAACCACCTGG - Intergenic
1107631277 13:42344857-42344879 CCTCCAACAGCATCACCCCAAGG - Intergenic
1107942991 13:45391288-45391310 CCAGCGCCAGCAGCAGCCCCAGG + Intergenic
1107986944 13:45783913-45783935 CCCCCACCACCTTCACCACCAGG - Exonic
1108000905 13:45904865-45904887 CCCAAACCAGCTGCACTCCCAGG - Intergenic
1108816714 13:54301526-54301548 CCCACACCAGCATCACACCAGGG + Intergenic
1110705998 13:78602347-78602369 CCACCACCACCACCACCACCAGG - Exonic
1111966203 13:94864644-94864666 ACCCCGCCAGCAGCTTCCCCGGG - Intergenic
1112290493 13:98141789-98141811 CGACCACCACCAGCAGCCCCTGG - Intergenic
1112372175 13:98803549-98803571 CCAGCAGCATCAGCACCCCCAGG - Intronic
1113714861 13:112496350-112496372 CGCCCGCCTGCTGCACCCCCTGG - Intronic
1114460533 14:22883591-22883613 CCCCCTCCCCCAGCACTCCCAGG + Intronic
1114985091 14:28217172-28217194 CCACCACCATCAGCAGCCCATGG + Intergenic
1117426893 14:55609154-55609176 CCCCCACCCGCAACAGGCCCTGG + Intronic
1118265988 14:64295078-64295100 CCCACCCCAGCAGGAGCCCCAGG + Intronic
1118571531 14:67199882-67199904 CCCCCATCGGCAGGAACCCCAGG + Intronic
1118595787 14:67434833-67434855 CCCTCACCAGATGCACCCCCTGG - Intergenic
1118600653 14:67469645-67469667 CCACCACCACCACCACCACCAGG - Intronic
1118775078 14:68968855-68968877 CCCCCAGCAGCAGCCAGCCCTGG - Intronic
1118895589 14:69942994-69943016 CCCCCACCACCAGCAGCCACAGG - Intronic
1119273478 14:73330981-73331003 CTTGTACCAGCAGCACCCCCAGG - Intronic
1119596342 14:75937965-75937987 CCCCCACCAGCCGCACACAAGGG + Intronic
1119745892 14:77043700-77043722 CTCCCCCCAGCAGTACCCCTTGG - Intergenic
1119996287 14:79257342-79257364 CCACCACCACCACCACCACCAGG - Intronic
1120874431 14:89362804-89362826 CCTCCACCACCACCACCACCAGG + Intronic
1121299863 14:92861750-92861772 CCCCCACGAGCACCACCAGCTGG + Intergenic
1121505666 14:94474704-94474726 CCCCAACGAGCAGTGCCCCCTGG - Intronic
1121632170 14:95429420-95429442 CCCCCAGCAGCAGCATCACCTGG + Intronic
1121698852 14:95936431-95936453 CCCCCACCACCAACCCCCTCTGG + Intergenic
1122235619 14:100329369-100329391 CCCCGGCCACCAGCACGCCCGGG - Exonic
1122293154 14:100690283-100690305 CTCCCACCTGCAGCACCTCCTGG - Intergenic
1122414002 14:101540160-101540182 GCTCCACCAGCAGCACTCCAGGG - Intergenic
1122647976 14:103207482-103207504 CGCTCCCCAGCAGCACACCCCGG - Intergenic
1122658570 14:103279216-103279238 CGCTCCCCAGCAGCACACCCCGG - Intergenic
1122864456 14:104597246-104597268 CCCCCACCAGCAGCACCCCCCGG + Intronic
1122951517 14:105047631-105047653 CTCCCACCAGCAGCACAAGCTGG + Intergenic
1122951986 14:105050240-105050262 CCCTCACCAGCATCTCCCCGAGG + Exonic
1122979061 14:105182937-105182959 CTTCCAGCAGCAGCAGCCCCGGG + Intergenic
1123432941 15:20233789-20233811 CACCCACCACCACCACACCCAGG + Intergenic
1124372921 15:29113611-29113633 CCCCCAGCTGCACCTCCCCCAGG - Intronic
1124477140 15:30045022-30045044 CCCCCACCAGCACGTCCTCCGGG - Intergenic
1124500355 15:30223050-30223072 CCCCCAACAGCAGCCGCCCCGGG + Intergenic
1124720663 15:32108571-32108593 GCCCCACCAGCAACCCCCACAGG - Intronic
1124743218 15:32315616-32315638 CCCCCAACAGCAGCCGCCCCGGG - Intergenic
1126760021 15:51961350-51961372 CCACCACCACCACCACCACCTGG - Intronic
1127676640 15:61245670-61245692 CCACCATCAGCAGCAGCACCTGG - Intergenic
1128302506 15:66575401-66575423 CCTCCACCCGCACCAACCCCAGG - Intergenic
1128329455 15:66746065-66746087 CCCCCAACCCCAGCACCCTCTGG - Intronic
1128758086 15:70196609-70196631 CCAGCACCAGCAGCACCCGCTGG + Intergenic
1128839506 15:70838550-70838572 CTATCACCAGCAGCACCACCTGG + Intronic
1129224638 15:74161607-74161629 CCACCACCACCACCACCACCAGG - Intergenic
1129357650 15:75002401-75002423 CCCCCAGCTGCAGCCCTCCCTGG + Intronic
1129437740 15:75555830-75555852 CCACCACCATCAGCATCCCTTGG - Intronic
1129603913 15:77015570-77015592 CCAGCATCAGCATCACCCCCAGG - Intronic
1130961658 15:88663559-88663581 CCCCCACCCGCCCCAGCCCCAGG + Intergenic
1131035921 15:89221928-89221950 CCCCCCCCACCACCACCACCAGG + Intergenic
1131064153 15:89422626-89422648 CTCCCTCCAGGAACACCCCCTGG - Intergenic
1131460573 15:92614770-92614792 CCGGCACCACCAGCACCACCAGG - Intergenic
1131481865 15:92789069-92789091 CCCCAACCAGCAGCAGCCCCTGG - Intronic
1132333602 15:101029128-101029150 TCCCCACCAGCAGCATCCTGAGG - Exonic
1132685696 16:1161170-1161192 CCCACACCACCAGCAGCCCAGGG - Intronic
1132869373 16:2108903-2108925 CCGCCACCAGCCCCAGCCCCCGG - Exonic
1133212379 16:4270856-4270878 CCTGCAGCAGCAGCAACCCCAGG + Intronic
1134609147 16:15593884-15593906 CCCCTGCCACCAGCACCCTCTGG - Intronic
1134718039 16:16366695-16366717 CCGCCACCAGCCCCAGCCCCCGG + Intergenic
1134956713 16:18385464-18385486 CCGCCACCAGCCCCAGCCCCCGG - Intergenic
1136115351 16:28091079-28091101 GCTCCACCAGCAGCACCGCAAGG + Intergenic
1136278263 16:29192130-29192152 GCCCCAGCAGCAGCACCCCCAGG - Intergenic
1136398601 16:30005939-30005961 CCCCCATCATCTGCACACCCGGG - Exonic
1136554383 16:30999139-30999161 CCTCCACCATCAGCTCACCCTGG - Intronic
1137531481 16:49281432-49281454 CCCCCAGCAGCAGCAGCTCCAGG + Exonic
1137532248 16:49285932-49285954 CCCCCGCCAACACCACACCCTGG + Intergenic
1137673345 16:50291882-50291904 CCCTCACCTGCAGCCCCACCCGG - Exonic
1137765546 16:50975074-50975096 TGCCCAGCAGCAGCACCCCATGG - Intergenic
1139489594 16:67279299-67279321 CCCCGCCCCGCCGCACCCCCGGG - Exonic
1139552561 16:67683199-67683221 CCACCAGCAGCAGCATCACCTGG - Intronic
1139601801 16:67991837-67991859 CCCACACCTGCAACACACCCTGG - Exonic
1140378582 16:74465541-74465563 GCAGCAGCAGCAGCACCCCCTGG - Intronic
1140455776 16:75104824-75104846 CCCCCTGCAGCAGCTCCTCCAGG - Exonic
1141128392 16:81417452-81417474 CTCAGACCAGCAGCAGCCCCAGG + Intergenic
1141159622 16:81620512-81620534 CCCCCACCATCCTCACTCCCAGG + Intronic
1141208635 16:81955785-81955807 CCCCCACCAGTACAACCTCCAGG - Intronic
1141607188 16:85160750-85160772 CACCCACCAGCCCAACCCCCTGG - Intergenic
1141635046 16:85310157-85310179 CCCCCACCACCTGCTCCCGCTGG + Intergenic
1141720786 16:85754199-85754221 CCGCCACCAGCCCCACCCCAAGG - Intergenic
1141755434 16:85987753-85987775 CCCCCCCCCCCACCACCCCCCGG + Intergenic
1141889406 16:86916660-86916682 CCCCTCCCAGCAGCACCCAGAGG + Intergenic
1141961455 16:87411990-87412012 CCACCACCATCAGCAGCCCCCGG - Exonic
1141975811 16:87515755-87515777 CACCCAGCACCAGCAACCCCAGG + Intergenic
1142082641 16:88158164-88158186 GCCCCAGCAGCAGCACCCCCAGG - Intergenic
1142227414 16:88884339-88884361 CCCACCCCAGGAGCCCCCCCAGG - Intronic
1142267302 16:89070592-89070614 CACCAGCCAGCAGCACCCCTAGG - Intergenic
1142267845 16:89072685-89072707 CACCCACCAGCACCCACCCCTGG - Intergenic
1142270749 16:89088216-89088238 CTCCCACCACCACCACTCCCCGG + Intergenic
1142354774 16:89597190-89597212 GCCCCACCGGCAGAACCCACAGG - Exonic
1142420361 16:89966166-89966188 CCCCTCACAGCAGCACACCCAGG - Exonic
1142496941 17:310904-310926 CCCCCTACAGCAGGGCCCCCAGG + Intronic
1142767619 17:2074422-2074444 GAGCCACCAGCAGCATCCCCTGG + Intronic
1143565224 17:7716975-7716997 CCCCGGCCCGCAGCGCCCCCTGG + Intergenic
1143915424 17:10288952-10288974 CCACCAGCATCAGCACCCCTGGG + Intergenic
1144329573 17:14211973-14211995 CCCCAGCCTGCAGCGCCCCCTGG - Intergenic
1144733702 17:17543049-17543071 CCCAGACCAGCAGCACCACCGGG + Intronic
1144808822 17:17985488-17985510 CCCCCATCCTCAGCACCCCAGGG - Intronic
1144856638 17:18272313-18272335 CACCCACCAGCAGCACACCAGGG - Intronic
1144892341 17:18501195-18501217 CAGCCACCAGCACCTCCCCCAGG + Intergenic
1144909709 17:18671302-18671324 CCACCACCAGCACCAAACCCAGG - Intronic
1145139873 17:20443093-20443115 CAGCCACCAGCACCTCCCCCAGG - Intergenic
1145166060 17:20614212-20614234 CCCCTCACAGCAGCACACCCAGG - Intergenic
1145904655 17:28509491-28509513 CCCTCACCAGCATCCCCGCCAGG + Intronic
1145962151 17:28893085-28893107 CCCCTACCAGCATCCTCCCCTGG + Intronic
1146062796 17:29615842-29615864 GCCCCAGCAGCAGCACACCCTGG - Exonic
1146637669 17:34518352-34518374 CCAGCACCAGCAGCATCACCTGG - Intergenic
1146836879 17:36118222-36118244 CCCCCACCGCCCCCACCCCCAGG + Intergenic
1147053857 17:37818899-37818921 CCAACACCAGCAGCAGCACCTGG - Intergenic
1147153986 17:38533972-38533994 CCACCACCACCACCACCACCTGG + Intronic
1147657431 17:42098662-42098684 CACCCACCCCCCGCACCCCCTGG - Intergenic
1147864543 17:43544161-43544183 GCCCCACCAGCGACACCCTCAGG + Intronic
1147999603 17:44380085-44380107 AGCCCAGCAGCAGCACCCGCCGG + Exonic
1148028477 17:44604408-44604430 CCAGCACCAGCAGCATCGCCTGG + Intergenic
1148116085 17:45175929-45175951 CCCTCTACAGCAGCACCCTCGGG - Intergenic
1148146098 17:45366081-45366103 CTCCCACCAGCAGCAGACCTTGG - Intergenic
1148357092 17:46982685-46982707 CCCTCCCCAGCACCTCCCCCAGG - Intronic
1148444379 17:47728624-47728646 GCCCCAGCTCCAGCACCCCCAGG + Intergenic
1148450847 17:47777133-47777155 CCTCCACCAGCCTCACCCACTGG + Intergenic
1148564150 17:48623462-48623484 GTCCCACCAGCAGCACTCCCAGG + Intronic
1148742210 17:49899213-49899235 CCCCGAGCAGCAGCGACCCCAGG + Intergenic
1148782737 17:50130566-50130588 CTCCCACCCCCAACACCCCCTGG - Intergenic
1148856211 17:50580459-50580481 CCTCCACCAGCAGCATCGGCTGG - Intronic
1149585487 17:57783355-57783377 CCCCCGCCACCCACACCCCCAGG - Intergenic
1149682758 17:58517528-58517550 CGCCCACTGGCAGCAGCCCCAGG + Intronic
1149866869 17:60156096-60156118 CCTTCATCAGCAGCCCCCCCGGG + Intronic
1150135329 17:62692253-62692275 CCGCCATCAGCACCACCACCAGG - Exonic
1150148173 17:62788431-62788453 CCAGCAGCAGCAGCAGCCCCAGG + Intronic
1150251014 17:63704442-63704464 GCCTGACCACCAGCACCCCCCGG - Exonic
1150326574 17:64262972-64262994 CGCCCACCCGCGACACCCCCGGG - Intronic
1150389585 17:64782475-64782497 TCCCCACCTGCAGCACAGCCAGG + Intergenic
1150788707 17:68183087-68183109 CTCACACCAGCAGCAACGCCGGG + Intergenic
1151565096 17:74893305-74893327 CCCCCACCCGCAGCCCGGCCGGG + Intronic
1151871817 17:76841738-76841760 CCCCCTCCAGCAGCGTCCTCCGG + Intergenic
1152049357 17:77959686-77959708 CGCCCACCCGCAGCACGCCCCGG - Intergenic
1152146500 17:78571878-78571900 CCACCAGCAGCAGCACCGTCTGG + Intronic
1152258393 17:79253614-79253636 CTCCAACCAGCAGCACCTCCTGG - Intronic
1152471464 17:80492178-80492200 CCACCACCTGCACCACCACCTGG - Intergenic
1152554457 17:81045988-81046010 CCCCCACCATGAGCCCCCCCAGG - Intronic
1152662162 17:81547540-81547562 CCTGCACCACCAGCACCACCTGG - Exonic
1152687434 17:81701528-81701550 CCCCCAGCAGCAGCCCCCCGTGG + Exonic
1152739364 17:82012298-82012320 CCCCGCCCCGCAGCACCCCAGGG - Intronic
1152756850 17:82090599-82090621 CCCCCAACAGCTGCACCTGCTGG - Intronic
1152918235 17:83052648-83052670 ACCCCACCAGGAGGTCCCCCAGG + Intergenic
1152918277 17:83052750-83052772 ACCCCACCAGGAGGTCCCCCAGG + Intergenic
1152918318 17:83052852-83052874 ACCCCACCAGGAGGTCCCCCAGG + Intergenic
1153659989 18:7317770-7317792 TCCCCAGCAGCAGCATCCCTAGG + Intergenic
1153666380 18:7370500-7370522 CTCCCACCAGCAGCAGCCCCGGG - Intergenic
1153817371 18:8802142-8802164 CCTCCACCAGCAGGAGTCCCTGG - Intronic
1153995244 18:10434595-10434617 CCACCAACAGCAGCAGCCCCTGG + Intergenic
1153999708 18:10472964-10472986 CGCCCACCCGCAGCAGGCCCGGG - Intronic
1154353410 18:13605988-13606010 CCACCAGCAGCAGCATCCCCTGG - Intronic
1154354050 18:13611338-13611360 CCCCCACCACAAGCACTGCCGGG - Intronic
1154979347 18:21489716-21489738 CCACCAGCAGCAGCAGCACCTGG - Intronic
1156522959 18:37737323-37737345 TCCCCACTTGCAGCTCCCCCTGG - Intergenic
1157304578 18:46507754-46507776 TCACCTCCACCAGCACCCCCTGG + Intronic
1157389157 18:47287000-47287022 CCCCAGCAAGCAGCACTCCCAGG - Intergenic
1157753298 18:50196436-50196458 CGCCCACCATCAGCATCACCTGG + Intergenic
1158538557 18:58330798-58330820 CCCCCACCACCGGCCTCCCCAGG + Exonic
1158570837 18:58595878-58595900 CCACCAGCATCAGCATCCCCTGG - Intronic
1159511286 18:69400912-69400934 CCGCCCCCGGCAGCACCCACGGG - Intergenic
1160029730 18:75248921-75248943 CACCCACCAGCAGCAGTACCAGG + Intronic
1160130179 18:76218434-76218456 TCCCCACCAGCAGCAACACAGGG - Intergenic
1160662173 19:306268-306290 CCCGCACCAGCAGCCTCCGCCGG - Exonic
1160731285 19:642724-642746 CAGCGACCAGCAGCACCCCAGGG - Intronic
1160763496 19:797303-797325 CCCCCGCCAGCACCTCCCACTGG - Exonic
1160928130 19:1556651-1556673 CCACCACCAGCCCCACCACCCGG + Exonic
1160960903 19:1720391-1720413 CCTCCCACCGCAGCACCCCCTGG + Intergenic
1161063706 19:2227537-2227559 CCCCGCCCCGCAGCAGCCCCAGG - Intronic
1161253853 19:3295540-3295562 CCCCCACCCCCACCACCTCCTGG + Intronic
1161487106 19:4542538-4542560 CCCCCACCCGTGCCACCCCCAGG + Intergenic
1161581041 19:5081270-5081292 CTCCCACCTGCTGCACCCCGGGG - Intronic
1161685469 19:5700657-5700679 TCCCCCCGACCAGCACCCCCAGG + Intronic
1161924730 19:7292456-7292478 CCCCCCCCAGCCCCGCCCCCAGG - Intronic
1162044014 19:7987105-7987127 CCCCCCCCCCCGGCACCCCCCGG - Intronic
1162343269 19:10105250-10105272 CCCCCACCCTCAGCCCCCTCTGG + Intergenic
1162468599 19:10858423-10858445 CCCCCACAAACAGCGCCTCCTGG + Intronic
1162746612 19:12802083-12802105 GCGCCAGCAGCAGCGCCCCCGGG - Intronic
1162925324 19:13928045-13928067 CCCCACCCATCAGCAACCCCAGG + Intronic
1162992871 19:14314709-14314731 CCCTCAACGCCAGCACCCCCTGG + Intergenic
1163366347 19:16877998-16878020 CACCCACCAGCAGCCCCCACTGG - Intronic
1163472596 19:17506034-17506056 CTCCCTCCAGCAGCACCCCCTGG + Exonic
1163500263 19:17672098-17672120 CCCCCACCACCAGCACCTTTCGG + Intronic
1163628013 19:18402045-18402067 CCCCCACCACCTGCAGCCTCGGG - Intergenic
1163774162 19:19208247-19208269 CCCCCACTGGCAGCAGCCCCTGG + Intergenic
1163818586 19:19483091-19483113 CCCCCAGCATCAGCACAGCCAGG - Intronic
1164476838 19:28582041-28582063 CCCCCGCCCTCACCACCCCCAGG + Intergenic
1165065024 19:33223970-33223992 CCACCACCACCACCACCACCAGG + Intronic
1165313546 19:35041851-35041873 CCCCCACCTGCTGGACCCCAGGG + Exonic
1165446096 19:35857379-35857401 CCTCCCCCAGCAGCACCACCAGG - Exonic
1166361864 19:42255820-42255842 CCCCCACCACCACCGTCCCCAGG + Intergenic
1166517693 19:43459847-43459869 AGACCAACAGCAGCACCCCCGGG + Intergenic
1166844253 19:45717258-45717280 CCCTCACCCGCAGCCCCCCCAGG + Intronic
1166862000 19:45816328-45816350 CTCCCAGCAGGAGCATCCCCTGG + Intronic
1167438117 19:49491554-49491576 CCCCCCTCAGCACCAGCCCCTGG - Intronic
1167700714 19:51043537-51043559 CCACCACCAGCACCAGCACCAGG - Intergenic
1168011906 19:53539712-53539734 CCCCCACCACCACCACCCTAAGG + Intronic
1168047003 19:53801267-53801289 CACACAGCAGCAGCACCCCGAGG + Exonic
1168233366 19:55047066-55047088 CCCAAACCAGCTGCACCTCCTGG - Intronic
1168270757 19:55248540-55248562 CCCTCACCACCATCACTCCCAGG + Intronic
1168649640 19:58085200-58085222 CCCGGACCCGCAGGACCCCCAGG - Exonic
924987786 2:287787-287809 CCAGCACCAGCAGCAGCCCCAGG + Exonic
925858909 2:8156413-8156435 CCCCCACCATCAGCAGCACCTGG + Intergenic
927156732 2:20225134-20225156 CCCCCACCCCCAGCTCCGCCAGG + Intronic
927187168 2:20490214-20490236 CCTCCAGCAGCAGCATCCTCTGG - Intergenic
927661986 2:25001090-25001112 CCCCCACCTGCAGCTGCACCTGG + Intergenic
927691759 2:25213370-25213392 CCCACAAAAGCAGCACCCCCTGG - Intergenic
927872573 2:26632975-26632997 CCCCCACCACGGGCACCACCGGG + Intronic
927895436 2:26778618-26778640 CCCCTCCCTGCAGAACCCCCAGG + Exonic
928089372 2:28364614-28364636 ACTCAACCATCAGCACCCCCAGG - Intergenic
928099337 2:28426476-28426498 CCCTCACCAGCCTCACCTCCAGG + Intergenic
928299270 2:30111236-30111258 CCCCCTTCAGCATCACACCCAGG + Intergenic
930036524 2:47088945-47088967 CCCCAACCAGCAGCCTCCCGAGG - Intronic
930131357 2:47854749-47854771 CCACCACCATCAGCATCCCTTGG - Intronic
931135507 2:59395301-59395323 CTCACAGCAACAGCACCCCCTGG - Intergenic
931193178 2:60025039-60025061 CACCCACCACCACCACCACCAGG + Intergenic
932053962 2:68425951-68425973 CCACCACCAGCAGCATCCCCTGG + Intergenic
932143239 2:69297622-69297644 GCCCCACAGGCAGCACCTCCTGG + Intergenic
933723069 2:85410407-85410429 CACCCACCAGCCCCACCCCTGGG + Exonic
934924888 2:98375310-98375332 CCGCCACCAGCAGCTCCTCAGGG - Intronic
935144922 2:100389100-100389122 CTCCCAGCAGCAGCTCCCCTTGG - Intergenic
935238953 2:101161687-101161709 CACACACCACCACCACCCCCCGG + Intronic
935405273 2:102702705-102702727 CCCACAGCAGCAGAACTCCCAGG - Intronic
935581730 2:104761508-104761530 AGCCCACCATCAGCTCCCCCTGG - Intergenic
935598196 2:104896304-104896326 CCCCAGCCACCTGCACCCCCAGG + Intergenic
935712540 2:105912155-105912177 TGTACACCAGCAGCACCCCCAGG + Intergenic
936284476 2:111171621-111171643 CCCCAGCCACCAGCACCCCGGGG + Intergenic
938092700 2:128443820-128443842 CCCCCCCCGGCAGCATCCGCAGG - Intergenic
938230832 2:129657336-129657358 CCCCCACCACCATCATCCCATGG + Intergenic
938314645 2:130317415-130317437 CCCCAACGATCTGCACCCCCAGG + Intergenic
938698324 2:133854493-133854515 CCAGCAGCAGCATCACCCCCTGG + Intergenic
941723407 2:168836338-168836360 CCCCCATCAGCAGCTTCCCTGGG + Intronic
942046527 2:172102316-172102338 CACCAACCAGCAGCACCCGGCGG - Exonic
942225191 2:173808707-173808729 CTTGCACAAGCAGCACCCCCAGG - Intergenic
942413657 2:175736581-175736603 CTCTCAACAGCAGGACCCCCTGG - Intergenic
944269043 2:197760389-197760411 TCCCCAGCAGATGCACCCCCAGG + Intronic
944450938 2:199841743-199841765 CCCTCACCAGCAACAGCCCATGG + Intronic
946422059 2:219570803-219570825 CCGCCCCCCGCAGCACCCACTGG + Exonic
946459098 2:219853227-219853249 CTCCCACCAGCAACACACCAGGG + Intergenic
946861200 2:224001696-224001718 CCCCCAGCTGAAGCATCCCCAGG + Exonic
947168712 2:227289227-227289249 CCCGGACCAGCAGGACCACCAGG + Exonic
947500591 2:230668231-230668253 CCACCACCGCCAGCACCACCAGG + Intergenic
947542885 2:230990851-230990873 CCTGCAACAGCAGCACGCCCGGG + Intergenic
947585213 2:231351852-231351874 CCTTCACCACCAGCACCCTCTGG + Intronic
947611690 2:231528681-231528703 GGCCCACCAGCAGCACCAGCAGG + Exonic
947659322 2:231855021-231855043 CCCTTGCCAGAAGCACCCCCAGG - Intergenic
948064913 2:235070351-235070373 TCCCAACAAGCAGCACCCCTAGG - Intergenic
948425739 2:237885792-237885814 CCCCCACCCTCTGCCCCCCCTGG + Intronic
948525459 2:238568318-238568340 CCCCCAGACGCAGCACCCCCGGG - Intergenic
948564510 2:238875358-238875380 CCTCCAACAGCACCACCCACTGG + Intronic
948718913 2:239883822-239883844 CGCCCACCAGCTGCCCCACCAGG + Intergenic
948777176 2:240295779-240295801 CTCCCACCAGCAGCGCACCCAGG + Intergenic
948974659 2:241456984-241457006 TCCCCACCAGCACCACCCGAAGG - Intronic
1168813192 20:719674-719696 CCTCCAGCTGCAGCTCCCCCAGG - Intergenic
1168995204 20:2128067-2128089 CCCAGACCAGCAGCATCACCTGG + Intronic
1169193271 20:3670788-3670810 GCCCCACCACCAGCACCGCAAGG - Intronic
1169879458 20:10330716-10330738 CCCAAACCAGCAGCATCACCTGG + Intergenic
1170226424 20:13995828-13995850 CCCCCACCGCCCGCACCCCCAGG - Intronic
1170629688 20:18056611-18056633 CCGCCACCTGCACCACGCCCTGG - Intronic
1170765919 20:19290049-19290071 CCACCAGCAGCAGCAGCCCCTGG + Intronic
1171454352 20:25259048-25259070 CCCCCAAAAGCAGCCCACCCAGG - Intronic
1171490099 20:25510774-25510796 CCGTCCCCAGCAGCACCCCCTGG - Intronic
1171493346 20:25537695-25537717 CCTCCACCTGCAGCAGCCCAGGG - Intronic
1172012107 20:31851547-31851569 CCTCCATCTGCAGCACCACCAGG - Intronic
1172039657 20:32034977-32034999 TCCCCACCAGCTGGATCCCCTGG + Intergenic
1172155319 20:32820047-32820069 GCCCCCCCAGCCGCACCCCCCGG - Intronic
1172273528 20:33667662-33667684 CCGCCACCAGCAGATCCCGCAGG - Exonic
1172590387 20:36113565-36113587 CCCCTACCCCCACCACCCCCAGG - Intronic
1173523361 20:43715039-43715061 CCCACCCCAGCACCACCACCTGG - Intronic
1173802738 20:45904947-45904969 CCCCCACCAGCAACAGCTGCAGG + Exonic
1174402386 20:50282988-50283010 CGGCCACCAGCACCACCGCCTGG + Intergenic
1175258000 20:57658424-57658446 AACTCACCAGCAGCACCCCCTGG + Intronic
1175912347 20:62410890-62410912 CCTCCCCCAACAGCAGCCCCTGG - Exonic
1176010073 20:62888543-62888565 TCACCACCATCAGCACCCTCAGG + Intronic
1176013777 20:62917100-62917122 CCCCCACCCACACCACCGCCAGG + Intronic
1176059986 20:63168300-63168322 CCCCAGGCAGCAGCACCTCCTGG + Intergenic
1176161707 20:63652012-63652034 CCCCCACCCCCAGTATCCCCGGG + Intronic
1176178171 20:63738274-63738296 CCCACACCAGGAGCTGCCCCGGG + Exonic
1176309598 21:5142645-5142667 CCCACACCAGCAGCTGGCCCAGG + Exonic
1178535035 21:33403790-33403812 CCCCCACCTGGGGCACCCGCAGG - Intronic
1179479298 21:41667404-41667426 CCCCCACCAGAAGCAGCCTGGGG + Intergenic
1179482274 21:41685815-41685837 CTCCCAGCAGCAGCACCGCCAGG - Intergenic
1179504331 21:41830918-41830940 CACCCTGCAGCAGCAGCCCCAGG + Intronic
1179545084 21:42108265-42108287 CCCCAACCCGGAGCACCCCCAGG + Intronic
1179724657 21:43335423-43335445 CCTCCCCCAGAAGCACCACCTGG - Intergenic
1179847462 21:44119388-44119410 CCCACACCAGCAGCTGGCCCAGG - Exonic
1179876919 21:44273285-44273307 CACCCACCAGCACCTCCGCCGGG + Intergenic
1179887011 21:44318608-44318630 CCCCCCCCATCAGAACCGCCTGG + Intronic
1179887404 21:44320120-44320142 CGCCCACCAGAAGCCCCCCAAGG + Exonic
1179890003 21:44330658-44330680 CCCGCACACGCAGCTCCCCCTGG + Exonic
1179899288 21:44380703-44380725 CCACCAGCAGCAGCACCCGAGGG - Intronic
1179999092 21:44987068-44987090 CGGCCCCCAGCATCACCCCCAGG - Intergenic
1180087843 21:45516029-45516051 CCACCACCCGCGGCAGCCCCCGG - Exonic
1180092529 21:45540382-45540404 TCCCCACCCACAGGACCCCCAGG + Intronic
1180876597 22:19177908-19177930 CCCCCTCCCGCAGCAGCCACCGG + Intronic
1180877017 22:19179220-19179242 CCCCCTCCCGCAGCAGCCACGGG + Intergenic
1181168139 22:20994143-20994165 GCCCCACCAGCAGCCACGCCGGG - Exonic
1181456375 22:23062323-23062345 CCCCCAACAGCAGCAGCTGCCGG + Intronic
1181751219 22:24990546-24990568 CCCACGCCAGCAGCAGCCCTGGG + Intronic
1182102370 22:27667266-27667288 CCACCACCAGCACTTCCCCCGGG + Intergenic
1182299609 22:29330302-29330324 CCTCCACCAGGGCCACCCCCTGG + Intronic
1182308486 22:29388193-29388215 CCCATACCCGCAGCACCTCCTGG - Intronic
1182420445 22:30246125-30246147 CCCCCTCCCGCAGCCACCCCGGG - Intronic
1182624263 22:31634474-31634496 GCCCCACCAGCAGCTCCCCAAGG + Intronic
1182793836 22:32976145-32976167 CTCCCAACAGCAGCCTCCCCTGG + Intronic
1183428493 22:37751929-37751951 CCCCTCCCAGCCCCACCCCCAGG - Intronic
1183457884 22:37932636-37932658 TCTCCTCCAGCAGCACCCCACGG - Exonic
1183489976 22:38110977-38110999 GACCCAGCAGCAGCAGCCCCTGG + Intergenic
1183519278 22:38287158-38287180 CCCCCAGCAGCAGCTCCCCAAGG + Intergenic
1183648544 22:39140714-39140736 CCCCCACCAGCAGGCAGCCCAGG - Intronic
1184441889 22:44522126-44522148 CCCCCACCCTCAGCACTCACTGG + Intergenic
1184490277 22:44804307-44804329 CCCCCAGCAGCAGCTCTCCTGGG - Intronic
1184690807 22:46116522-46116544 CCCCCACCATCCGCCCCGCCTGG + Intergenic
1184915300 22:47564768-47564790 CATCCATCAGCAGCACCCCAGGG - Intergenic
1185121802 22:48975699-48975721 CCCCCACGAGCTGAGCCCCCAGG + Intergenic
1185193861 22:49455925-49455947 ACCCCACCAGCAGCACCCAGAGG + Intronic
1185244577 22:49766148-49766170 ACCCCCACAGCAGCACACCCAGG + Intergenic
1185273395 22:49938872-49938894 ACACCAGCAGCTGCACCCCCCGG + Intergenic
1185384917 22:50527182-50527204 CCCCAACCAGGAGCAGGCCCGGG - Exonic
950663770 3:14482662-14482684 CTGCCACCAGCACCACCTCCAGG - Intronic
952818941 3:37469190-37469212 TCCCCAGCAGGAGCATCCCCCGG - Intronic
952819478 3:37473471-37473493 CCCCTTCCCACAGCACCCCCAGG - Intronic
952883962 3:38001689-38001711 CCCCCACCTGCAGGGCCACCAGG + Exonic
953006019 3:38980037-38980059 CCCACACCAGCACCAGGCCCAGG + Intergenic
953274214 3:41479039-41479061 CCCTCATCAGCAGCACAGCCTGG + Intronic
953883005 3:46701235-46701257 CCCCCACCTTCCGCATCCCCAGG - Intergenic
954405481 3:50342885-50342907 CCCCCACCAGCCTAAGCCCCAGG - Intronic
954481701 3:50806017-50806039 CCCTCTACAGAAGCACCCCCAGG - Intronic
954652930 3:52176260-52176282 GCCCCACCAGGATCACCCCATGG + Intergenic
954682120 3:52351464-52351486 CCCCCACGACCAGCATCCCTAGG + Intronic
954797521 3:53169033-53169055 CTCCCACCACCACCATCCCCAGG - Intronic
954808528 3:53234047-53234069 ACAACCCCAGCAGCACCCCCAGG - Intronic
955320937 3:57973782-57973804 GGACCACCAGCAGCACCACCAGG - Intergenic
960192118 3:114719177-114719199 CCCCCCCCTGCACAACCCCCTGG - Intronic
961012968 3:123448338-123448360 CCCGCAGCAGCAGCAGCGCCTGG - Exonic
961463452 3:127067610-127067632 CCCCCAACACCAGCACAGCCTGG + Intergenic
961567589 3:127774720-127774742 GCAGCAGCAGCAGCACCCCCAGG + Intronic
961660651 3:128467184-128467206 CCACCACCATCACCACCACCGGG - Intronic
961823471 3:129586909-129586931 CCCCCACCAGGAGCTCCTTCTGG + Intronic
961989736 3:131175584-131175606 CTCCCACCACTACCACCCCCAGG - Intronic
962092688 3:132261879-132261901 CCACCACCACCACCACCACCAGG + Intronic
962318856 3:134374872-134374894 TCCCCTCCCGCAGCAACCCCAGG - Intronic
962384322 3:134920803-134920825 GCCCCACCATCCGGACCCCCAGG + Intronic
963091347 3:141486775-141486797 TCCCCACCAGGAGAACGCCCCGG - Intergenic
963168045 3:142225181-142225203 CGGCCACCTGCAGCACCCGCGGG - Intronic
964720639 3:159764832-159764854 CCTCCACCAGCACGACCCCCAGG + Exonic
965271629 3:166623411-166623433 CCCCCACCCCCAGCAGGCCCTGG - Intergenic
966874845 3:184315824-184315846 CCCCCACCCGCCCCATCCCCCGG + Exonic
966887233 3:184383426-184383448 CCCCCACCTTCTGCAGCCCCTGG - Intronic
968086585 3:195876693-195876715 GCCCCACCAGCAGCAGCCACAGG + Intronic
968087727 3:195881484-195881506 CCCCCCCCAGCAACGCCCCTTGG + Intronic
968132104 3:196197946-196197968 CTCCCGCCACCCGCACCCCCTGG + Intronic
968565768 4:1311911-1311933 GCCCCACCAGCCCCACACCCAGG - Intronic
968644783 4:1735035-1735057 TCCCTGCCAGCAGCACCTCCAGG - Intronic
968645361 4:1737918-1737940 TGCCCACCAGCAGCCTCCCCGGG + Intronic
968706343 4:2080200-2080222 TCACCACTTGCAGCACCCCCAGG + Intronic
968917150 4:3501561-3501583 CCCCAACCCCGAGCACCCCCAGG - Intergenic
968958349 4:3730417-3730439 CCCCCACCAGCACCCGCCCTGGG - Intergenic
969235650 4:5863615-5863637 CCCCCAACACCATCACCTCCCGG + Intronic
969369179 4:6720429-6720451 CCCGCTCCTGCAGCGCCCCCTGG - Intergenic
969448207 4:7257366-7257388 TCCCCACCCCCACCACCCCCAGG - Intronic
969559720 4:7939453-7939475 CCCCCACCCGCAGGACGACCGGG + Exonic
969582131 4:8071696-8071718 CACCCACCCGCAGCCCCTCCTGG + Intronic
970652078 4:18189899-18189921 CCTGCACCATCAGCAGCCCCTGG - Intergenic
974950286 4:68578111-68578133 CCCCAACCAGGAGCCCCACCAGG + Intronic
975379461 4:73681532-73681554 CCCCTACCCCCACCACCCCCAGG - Intergenic
976689707 4:87855802-87855824 CCACCACCACCACCACCTCCGGG + Intergenic
978505618 4:109453354-109453376 TGGCCTCCAGCAGCACCCCCAGG - Intronic
981005063 4:139866099-139866121 ACCCAACCTGCAGAACCCCCAGG + Intronic
982249457 4:153389906-153389928 CCCCAACTAGCAGCATCACCTGG + Intronic
982319864 4:154066952-154066974 CCCCCAGCAGACACACCCCCAGG - Intergenic
984185168 4:176534814-176534836 CCCCCACCATCTCCACCCTCTGG - Intergenic
984942213 4:184942990-184943012 CCCTCACCAGAAGCAGACCCTGG - Intergenic
985540332 5:484656-484678 CCCCCACCAGCGTGCCCCCCAGG + Exonic
985549089 5:524271-524293 CCAGCGCCAGCAGCAGCCCCCGG + Exonic
985608975 5:876041-876063 TTCCCGCCAGCAGCACCCCAAGG + Intronic
985827446 5:2203514-2203536 CCTCCAAAAGCAGCACCCTCAGG + Intergenic
985870148 5:2548054-2548076 CCCTCACCAGGAGCATCTCCAGG - Intergenic
985989052 5:3540007-3540029 CTCCCTCCAGCAGCAACCGCTGG - Intergenic
986176770 5:5359217-5359239 CCCATTTCAGCAGCACCCCCAGG + Intergenic
986709842 5:10480670-10480692 CCCGCAGCATCAGCATCCCCTGG + Intergenic
987090167 5:14503287-14503309 CTCCAGCCAGCAGCACCCTCTGG + Intronic
989229796 5:39073864-39073886 CCCGCACCCGCAGCAGCCCGAGG + Intronic
989600140 5:43192928-43192950 TCTCCACCAGCAGCACCGGCCGG - Exonic
990500291 5:56389900-56389922 TCCTCACCAGCAGGTCCCCCAGG + Intergenic
990736966 5:58875134-58875156 CCCCAACCAGCAGCAGGACCAGG + Intergenic
992781524 5:80132493-80132515 CCCCAACCTGGAGCACCTCCTGG + Intronic
994072720 5:95620419-95620441 CCACCACCAGGATGACCCCCAGG - Exonic
994241234 5:97423962-97423984 CCCCCAACACCAGCAGCCCCTGG + Intergenic
996204464 5:120714975-120714997 CCCCCACCACCAACAGGCCCTGG - Intergenic
996900709 5:128538666-128538688 CCCCCTCCAGCCGGCCCCCCGGG - Intronic
997280807 5:132643706-132643728 CCCACCCCACCACCACCCCCAGG - Exonic
997470877 5:134116012-134116034 CCCCCAGCCGCAGCCCCCGCTGG + Exonic
998135039 5:139670000-139670022 ACCCCCCCAGCACCTCCCCCAGG - Intronic
998387161 5:141763990-141764012 ATCCATCCAGCAGCACCCCCAGG - Intergenic
999206812 5:149854234-149854256 CCCCCTACAGTAGTACCCCCGGG - Exonic
999701608 5:154233616-154233638 CCCCCACCAGCCGCCCACCATGG + Intronic
999999170 5:157120844-157120866 CCCCCACCAGACACACACCCAGG + Intronic
1000024626 5:157347937-157347959 CGCTCACCAGCAGCACCCAGAGG + Intronic
1000351528 5:160356487-160356509 CCACCATCAGCAGCATCCCTTGG - Intronic
1001039672 5:168325209-168325231 CCCCTACCAACAGCTCCCACAGG + Intronic
1002069760 5:176672238-176672260 CCCCTTCCTGCCGCACCCCCAGG - Intergenic
1002081347 5:176739508-176739530 CCCACACCAGCAGCACCTGCTGG - Intergenic
1002923831 6:1593543-1593565 TCCCCAGCAGCACCACCCACTGG + Intergenic
1003026371 6:2558926-2558948 CCCCCACCAGCCTGGCCCCCTGG - Intergenic
1003202027 6:3970041-3970063 CCACCACCACCACCACCACCAGG - Intergenic
1003394152 6:5739028-5739050 CCCCCACCATCACTACCCTCTGG + Intronic
1003429282 6:6024152-6024174 CCACCACCACCAGCCCCCACTGG - Intergenic
1003500258 6:6697246-6697268 CCAGCAGCATCAGCACCCCCTGG + Intergenic
1003513642 6:6801679-6801701 CCCTCACCAGCAGCCACGCCTGG + Intergenic
1003557282 6:7151430-7151452 CCCCCAGGAGCAGCAGGCCCTGG + Intronic
1003624147 6:7727249-7727271 CCTCCAACAGCCGCAGCCCCCGG + Exonic
1004457461 6:15804170-15804192 CCCGCAGCATCAGCATCCCCTGG - Intergenic
1004494239 6:16148670-16148692 CACACACCAGCAGCACCAGCTGG - Intergenic
1005496132 6:26389446-26389468 GCCACACCAGCATCACCTCCTGG - Intronic
1006058627 6:31403687-31403709 CACTCACCAGCAGCAGCTCCCGG - Exonic
1006162952 6:32048594-32048616 CCGCCACCGCCAGCTCCCCCAGG + Intronic
1006300261 6:33190350-33190372 CCCCCACCAACCCCACCACCTGG + Intronic
1006314294 6:33280851-33280873 CCGCCACCAGCAGTCCCCTCTGG + Exonic
1006866224 6:37211151-37211173 CCCCCACCACCCCCACCCCATGG + Intergenic
1006980512 6:38144016-38144038 CTCCCACCAGCAGCAATCCCTGG - Intronic
1007223533 6:40296990-40297012 CCCCCACCCCCAGCCCACCCCGG - Intergenic
1007260546 6:40559981-40560003 CCCACACCTGCCTCACCCCCAGG + Intronic
1007377644 6:41467651-41467673 CCCCCCCCAGCTCCACCCCAAGG - Intergenic
1007415833 6:41690760-41690782 CCCCCACCAGCCGCCTCCCCAGG - Exonic
1007516719 6:42418594-42418616 CCTGCACCAGCAGCATCACCTGG - Intronic
1007925639 6:45647416-45647438 CCCTCACAAGCAGCACTCTCAGG - Intronic
1007951352 6:45875314-45875336 CTACCACCATCAGCAACCCCTGG - Intergenic
1008036462 6:46750025-46750047 CCAGCAGCAGCAGCAGCCCCTGG - Intronic
1008685910 6:53926017-53926039 CACACACCAGCAGCATGCCCAGG - Intergenic
1009940478 6:70283001-70283023 GCCCCAACAGCAGCAGCCCCAGG + Intronic
1010644811 6:78373833-78373855 CCACCACCACCACCACCCCATGG + Intergenic
1011075227 6:83431240-83431262 CCGCCACCAGCAGCGCTGCCAGG - Intergenic
1011603645 6:89081513-89081535 CCCCCACCCGCCCGACCCCCCGG - Intronic
1012419274 6:99044993-99045015 GCTCCACCAGCAACACCCACAGG + Intergenic
1012551798 6:100469889-100469911 CCCTCACCAGCAACATCACCTGG - Intergenic
1012878961 6:104762537-104762559 CCCCCACCCTCAGCAGGCCCTGG - Intronic
1013095959 6:106945004-106945026 CCCCCAAAAGCAGCAGGCCCAGG - Intergenic
1013283959 6:108664435-108664457 CCACCACCAGCACCAAACCCAGG + Exonic
1015773517 6:136792191-136792213 CCCCGCCCAGCCGCACCGCCTGG + Exonic
1016590190 6:145735429-145735451 CCACCACCAGCAGCTCCGGCCGG + Exonic
1016969670 6:149750174-149750196 CCCCCACCAGCAGCGGCCCCTGG - Intronic
1016990717 6:149925960-149925982 CGCCCTCCCGCAGCAGCCCCAGG - Intergenic
1016992279 6:149938515-149938537 CGCCCTCCCGCAGCAGCCCCAGG + Intergenic
1017007444 6:150038097-150038119 CGCCCTCCCGCAGCATCCCCAGG - Intergenic
1017818056 6:158029108-158029130 CCTCCACTTGCACCACCCCCGGG + Intronic
1017845577 6:158255183-158255205 CCCCCTCCAGCAACACCTGCAGG - Intronic
1018750361 6:166798825-166798847 CCACCACCAGGAACACACCCTGG - Intronic
1018854994 6:167668890-167668912 CCCCCACTGGCTGCACCCCCGGG - Intergenic
1018900791 6:168050796-168050818 CCTCCCACAGCAACACCCCCAGG - Intergenic
1018984335 6:168624980-168625002 CCACCACCAGCAGCACCATCTGG + Intronic
1019215286 6:170439106-170439128 CTCCCAGCTGCAGAACCCCCAGG - Intergenic
1019306743 7:339054-339076 CTCCCACCAGCAGCACCTGGAGG - Intergenic
1019379588 7:713878-713900 CCCTCACCCTCAGCACCCACTGG + Intronic
1019593512 7:1847630-1847652 CCCCCTCCAGCAGCTGCCCTCGG + Exonic
1019701667 7:2477241-2477263 CACCCACCTGCAGCAGCCCTAGG - Intergenic
1019723943 7:2590290-2590312 GCCCCACCAGCAGCCTCACCAGG + Intronic
1020283692 7:6664244-6664266 CCCACACCCGCCGCACCCGCCGG - Intergenic
1020430724 7:8113870-8113892 CCGCCCCCAGCAGCTCCCCTGGG - Exonic
1020473215 7:8563649-8563671 CCCCAACCAGAATCACCCCAAGG - Intronic
1020914485 7:14175429-14175451 CCTCCACCTCCTGCACCCCCAGG + Intronic
1021313175 7:19117146-19117168 CCCCCACCCGCGGCTCCGCCGGG + Exonic
1021902899 7:25305160-25305182 CCCCCTCCAGCAGCCTCCACTGG + Intergenic
1022106234 7:27199748-27199770 CCGCCTACAGCAGCGCCCCCGGG - Exonic
1022953661 7:35362380-35362402 ACACCACCAGCAGCACCTCAAGG + Intergenic
1023965842 7:44962713-44962735 CCCGCACCCGCCGCACCCCGAGG - Exonic
1023993705 7:45146048-45146070 CCCCCGCCATCAGCATTCCCTGG - Intergenic
1024058662 7:45682462-45682484 GCCCCACCTGCAGCACCCCGGGG - Intronic
1024288999 7:47786802-47786824 GCCCAATCAGCAGCAGCCCCCGG + Intronic
1024639235 7:51316467-51316489 CCACTACCACCAGCACCCGCTGG + Intronic
1024785641 7:52903978-52904000 TCCCCACCCCCAGCAGCCCCTGG - Intergenic
1024985126 7:55187824-55187846 CCCTCCCCACCAGCACCCCAAGG + Intronic
1025261876 7:57425400-57425422 CCGCAGCCAGCAGCTCCCCCAGG - Intergenic
1026109609 7:67448732-67448754 CCCTCACCAGCTGCTCCCACTGG - Intergenic
1026244829 7:68610678-68610700 CCCCCACCATCACCTCCCCGGGG - Intergenic
1029135296 7:98366313-98366335 CCACCACCAGCAGCTCCCTCTGG - Intronic
1029706259 7:102277939-102277961 CCCCCCCCAGGAGAACCGCCTGG + Intronic
1032016236 7:128381853-128381875 CCCCCACCAGCTTCACCCCCTGG - Intergenic
1032438562 7:131922751-131922773 CCCCCACCAACTCCAGCCCCTGG + Intergenic
1035337304 7:158138244-158138266 CCCCTCCCCGCAGCACCCCTGGG + Intronic
1035796543 8:2362572-2362594 TCCCCACAAGCAGCTCCCCAGGG + Intergenic
1036201498 8:6774557-6774579 CTGCCATCAGCAGCACCCCTTGG + Intergenic
1036222072 8:6929470-6929492 CCCCCACCTGTAGCTTCCCCAGG - Intergenic
1036768989 8:11565972-11565994 CCCCCACCAGCCACGTCCCCTGG - Intergenic
1036777036 8:11620659-11620681 CCCCCTCCAGAAGCAGCCCCGGG - Intergenic
1037540094 8:19862582-19862604 CCCCCACAGACAGCCCCCCCAGG + Intergenic
1037828974 8:22177189-22177211 CCCCCACCTCCAGGACCCCTGGG + Intronic
1039546767 8:38416132-38416154 CCACCCCCAGCAGCACACCCCGG + Intronic
1039843370 8:41309096-41309118 CCAGCGCCAGCAGCACGCCCAGG + Exonic
1039845692 8:41324027-41324049 TCCCCATCAGCACCATCCCCAGG + Intergenic
1040052802 8:43033044-43033066 CCCCCCCCAGCCGCCCCGCCCGG - Intronic
1040839653 8:51771804-51771826 CACCCACAGGCAGCACCGCCTGG - Intronic
1041108008 8:54459713-54459735 CCAGCACCAGCACCACCCCCCGG + Exonic
1041464190 8:58142555-58142577 CCCCTGCCACCATCACCCCCAGG + Intronic
1042659281 8:71135680-71135702 CCCCCACCTGAAGCACTCCATGG - Intergenic
1042968764 8:74385332-74385354 CCCCCACCACCAACAGGCCCCGG + Intronic
1043515231 8:80989832-80989854 CCCACAGCAGCAGCAGCACCTGG - Intronic
1045281911 8:100756831-100756853 CCCCCAGCAGCTGCATCACCTGG + Intergenic
1045337767 8:101224047-101224069 CCCGCAGCAGCAGCGCCCTCTGG - Intergenic
1045432141 8:102124142-102124164 TCCCCCCCAGCAGCCGCCCCCGG + Intronic
1046131426 8:109973122-109973144 TACGCACCACCAGCACCCCCGGG + Intronic
1046635811 8:116674307-116674329 CCCCCCCCACCTCCACCCCCAGG - Intronic
1047381860 8:124372047-124372069 CCCCCGCCCGCAGCAGCACCAGG + Exonic
1049197244 8:141322652-141322674 CCCACACCTGGAGCACCCTCAGG + Intergenic
1049257746 8:141622938-141622960 CTCCCATCAGCAGCCTCCCCTGG - Intergenic
1049272144 8:141701457-141701479 CCCCTCCCACCAGTACCCCCAGG - Intergenic
1049368990 8:142254581-142254603 CCCCTCCCTCCAGCACCCCCTGG + Intronic
1049578635 8:143400902-143400924 CCCCACCCAGCTGCACACCCAGG - Intergenic
1049641909 8:143719651-143719673 CCACCCCCAGCAGCTCCTCCTGG - Intronic
1049797566 8:144503663-144503685 CCCCTCCCCCCAGCACCCCCTGG + Intronic
1051658445 9:19404639-19404661 CCAGCAGCAGCAGCATCCCCTGG - Intergenic
1053006891 9:34610875-34610897 CAACCCCCAGGAGCACCCCCTGG - Exonic
1053351459 9:37416109-37416131 CCACCAGCAGCAGCATCACCCGG + Intergenic
1053429681 9:38033858-38033880 ACCCCCCCAGCACCACCTCCTGG + Intronic
1055774821 9:79755886-79755908 TCCCCACCAGAAGCATCACCTGG + Intergenic
1056052251 9:82781381-82781403 CCACCAGCAGCAGCATCACCTGG + Intergenic
1056071697 9:82993806-82993828 CCTCCACCAGCTGGACCCACTGG + Intronic
1056862477 9:90198970-90198992 CCCCCTCCAGCAGTGCCCCCTGG + Intergenic
1057274362 9:93668492-93668514 CCCCAACCCCCAGGACCCCCAGG - Intronic
1057280605 9:93708536-93708558 CCCCTCCCAGCAGCACCCTCTGG - Intergenic
1057304580 9:93904785-93904807 CCCTCACCTCAAGCACCCCCAGG - Intergenic
1058703154 9:107617365-107617387 CACCCACCAGCAGAATCACCTGG - Intergenic
1059368697 9:113807649-113807671 CCCCAACCCCCAGCACACCCCGG + Intergenic
1060508702 9:124216797-124216819 CCCCCACCCACAGCTGCCCCTGG - Intergenic
1060794495 9:126504798-126504820 CCCCCACCAGGGGCATCCTCGGG - Exonic
1060855943 9:126915067-126915089 CCCACACCTGCAGCTCCCTCAGG - Intronic
1060986044 9:127819565-127819587 CCCGGCCCAGCAGCAGCCCCTGG + Intronic
1061036634 9:128118028-128118050 TCCCCATCTGCAGCAGCCCCGGG + Intergenic
1061478553 9:130884991-130885013 CCCCCACCAGCAGCCTCTGCAGG + Exonic
1061625595 9:131839044-131839066 CCCACGGCAGAAGCACCCCCTGG - Intergenic
1061757155 9:132823268-132823290 GCCCGAGCAGCAGCACCCTCGGG + Exonic
1061835728 9:133328323-133328345 CCCCCACCTGCAGCCCTCACTGG + Intergenic
1061860077 9:133463580-133463602 TCCCGACCAGCAAGACCCCCGGG - Intronic
1061993655 9:134173447-134173469 GCCTCACCAGCAGCCCTCCCGGG - Intergenic
1062047857 9:134432704-134432726 CGCCCACCAGCAGGCACCCCCGG + Intronic
1062076876 9:134594459-134594481 CCCCCAGCAGCACCTGCCCCAGG + Intergenic
1062077741 9:134601062-134601084 CCACAGCCAGCAGCACACCCCGG - Intergenic
1062120518 9:134831580-134831602 CCCCCAGCAGCTTCACCCCCAGG - Intronic
1062207733 9:135346656-135346678 CCACCCCCAGCAGCTCCTCCTGG + Intergenic
1062212556 9:135372721-135372743 CCCCTCCCAGCAGCCCCTCCTGG - Intergenic
1062283773 9:135763937-135763959 CCCCCGCCAGCACCATCCGCGGG + Intronic
1062354921 9:136157412-136157434 CCCCCACCACGAGCAGGCCCAGG - Intergenic
1062451382 9:136617164-136617186 CCCACACCCCCATCACCCCCAGG - Intergenic
1062539595 9:137035694-137035716 CCCCACCCAGCAGCTCCACCTGG - Exonic
1185722820 X:2395630-2395652 CCACCTCCAGCGGAACCCCCAGG + Intronic
1185763885 X:2708860-2708882 CCGCCACCAGTGTCACCCCCAGG - Intronic
1186246202 X:7619331-7619353 CCACCAGCAGCAGCATCACCTGG + Intergenic
1188123719 X:26341696-26341718 CCCTCACCACCACCAACCCCAGG - Intergenic
1189901359 X:45710245-45710267 CCCCCACCATCACCACCACAGGG - Intergenic
1190214193 X:48469121-48469143 CCCCCACCACCAGCACCCTCCGG + Intronic
1191716841 X:64199692-64199714 CTCCCTACCGCAGCACCCCCTGG + Intronic
1191911877 X:66160345-66160367 CCAGCAGCAGCAGCATCCCCTGG + Intergenic
1192077439 X:68014472-68014494 CCCCCAGAAGGACCACCCCCAGG - Intergenic
1192360422 X:70435315-70435337 CCCCAATGAGCAGCTCCCCCGGG - Intergenic
1193201577 X:78697675-78697697 CCCCCACCTCCAACACGCCCTGG - Intergenic
1193359307 X:80561601-80561623 CCCCCACCAAGAGTACCTCCAGG + Intergenic
1196019064 X:110970584-110970606 CCCCCACCCACAGCAGGCCCTGG - Intronic
1196441326 X:115722470-115722492 GCGCCACCAGCAGCATCCCCTGG + Intergenic
1196444855 X:115840459-115840481 GCGCCACCAGCAGCATCCCCTGG + Intergenic
1196465736 X:115969713-115969735 CGCCAAACAGCAGCATCCCCTGG - Intergenic
1197366199 X:125567269-125567291 CCCCCACCCCCATCACTCCCGGG - Intergenic
1198286194 X:135194423-135194445 CCCACAGCAGCAGGACCCACAGG - Intergenic
1198286219 X:135194529-135194551 CCCACAGCAGCAGGACCCACAGG - Intergenic
1198286227 X:135194559-135194581 CCCACAGCAGCAGGACCCACAGG - Intergenic
1198341670 X:135720137-135720159 GCCCAACCAGCAGCAGCTCCTGG + Intronic
1198346328 X:135763224-135763246 GCCCAACCAGCAGCAGCTCCTGG - Intronic
1198348234 X:135780509-135780531 GCCCAACCAGCAGCAGCTCCTGG - Intergenic
1198350136 X:135797772-135797794 GCCCAACCAGCAGCAGCTCCTGG - Intronic
1198352046 X:135815045-135815067 GCCCAACCAGCAGCAGCTCCTGG - Intronic
1198353954 X:135832313-135832335 GCCCAACCAGCAGCAGCTCCTGG - Intronic
1198355862 X:135849563-135849585 GCCCAACCAGCAGCAGCTCCTGG - Intronic
1198357773 X:135866842-135866864 GCCCAACCAGCAGCAGCTCCTGG - Intergenic
1198359691 X:135884124-135884146 GCCCAACCAGCAGCAGCTCCTGG - Intronic
1198366545 X:135945902-135945924 GCCCAACCAGCAGCAGCTCCTGG - Intergenic
1199006061 X:142697481-142697503 CCCCCACCACCCCCAGCCCCAGG + Intergenic
1200068301 X:153515456-153515478 CCCCCAGCAGGAGCATCCCTTGG - Intergenic
1200074928 X:153546169-153546191 CCTCCACCAGCCCCACCCCCAGG - Intronic
1200081950 X:153581584-153581606 CTCCCACCACCAGCTCCTCCGGG - Exonic
1200102049 X:153693076-153693098 CACGCACCAGCAGCACGACCAGG - Exonic
1200765532 Y:7077715-7077737 CCCCATCCAGCTTCACCCCCAGG - Intronic