ID: 1122864566

View in Genome Browser
Species Human (GRCh38)
Location 14:104597666-104597688
Sequence AAGAGGAACGGGCCCTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 147}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122864556_1122864566 25 Left 1122864556 14:104597618-104597640 CCTAGGAGAGACCCCACCAAGCG 0: 1
1: 0
2: 2
3: 3
4: 89
Right 1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG 0: 1
1: 0
2: 3
3: 19
4: 147
1122864559_1122864566 12 Left 1122864559 14:104597631-104597653 CCACCAAGCGAGCTCCCAGCAGA 0: 1
1: 0
2: 0
3: 5
4: 130
Right 1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG 0: 1
1: 0
2: 3
3: 19
4: 147
1122864560_1122864566 9 Left 1122864560 14:104597634-104597656 CCAAGCGAGCTCCCAGCAGATAA 0: 1
1: 0
2: 1
3: 1
4: 83
Right 1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG 0: 1
1: 0
2: 3
3: 19
4: 147
1122864561_1122864566 -2 Left 1122864561 14:104597645-104597667 CCCAGCAGATAACGACACAGCAA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG 0: 1
1: 0
2: 3
3: 19
4: 147
1122864562_1122864566 -3 Left 1122864562 14:104597646-104597668 CCAGCAGATAACGACACAGCAAG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG 0: 1
1: 0
2: 3
3: 19
4: 147
1122864555_1122864566 28 Left 1122864555 14:104597615-104597637 CCTCCTAGGAGAGACCCCACCAA 0: 1
1: 0
2: 0
3: 14
4: 118
Right 1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG 0: 1
1: 0
2: 3
3: 19
4: 147
1122864554_1122864566 29 Left 1122864554 14:104597614-104597636 CCCTCCTAGGAGAGACCCCACCA 0: 1
1: 0
2: 1
3: 11
4: 133
Right 1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG 0: 1
1: 0
2: 3
3: 19
4: 147
1122864557_1122864566 14 Left 1122864557 14:104597629-104597651 CCCCACCAAGCGAGCTCCCAGCA 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG 0: 1
1: 0
2: 3
3: 19
4: 147
1122864558_1122864566 13 Left 1122864558 14:104597630-104597652 CCCACCAAGCGAGCTCCCAGCAG 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG 0: 1
1: 0
2: 3
3: 19
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122864566 Original CRISPR AAGAGGAACGGGCCCTCAGC AGG Intronic
900716910 1:4150854-4150876 AGAGGGGACGGGCCCTCAGCTGG + Intergenic
901548690 1:9978852-9978874 TAAAGGAAGGGGCCCTAAGCAGG - Intronic
902379073 1:16044177-16044199 AAGGGGAAGGGGCTCTGAGCAGG + Intronic
904299242 1:29543506-29543528 ATGAGGAATGGGCCCTCAGCAGG + Intergenic
905656039 1:39686706-39686728 AAGAGGTACAGGCCCTCCTCAGG + Intronic
906652825 1:47525190-47525212 AAGAGGAAGGGACCCTCTCCTGG - Intergenic
907704484 1:56820591-56820613 TAGAGGAAATGGCCCTCAGGCGG - Intergenic
907889646 1:58624424-58624446 ATGAGGAAGGGGACCCCAGCGGG - Intergenic
907992460 1:59596088-59596110 AAGAAGAAAGAGCCCTCAGAGGG - Intronic
909139599 1:71846735-71846757 ATAAGGAACAGGCCCTCACCGGG - Intronic
910022301 1:82606713-82606735 AGGAGGGAAGGGTCCTCAGCTGG + Intergenic
917080287 1:171251299-171251321 AAGTGGCTCGGACCCTCAGCTGG + Intronic
918827855 1:189349803-189349825 AAGAGGGACTGGCCGGCAGCAGG - Intergenic
920727448 1:208449564-208449586 AAGTGGAACGGGCATTCTGCTGG - Intergenic
923072337 1:230577553-230577575 AAGGGGAATGGGCCATCAGGAGG - Intergenic
923290247 1:232538363-232538385 AACAGTAACTGGCCCTCAGCAGG + Intronic
1063364539 10:5481744-5481766 AAGAGGAACGGGACCCCGGAAGG - Intergenic
1068932043 10:62601196-62601218 ATGAGGAATGGGCCCTCACCAGG - Intronic
1070757114 10:79000185-79000207 GAGAGGAACGGGGTCTCACCTGG - Intergenic
1070810105 10:79293353-79293375 AAGAGGAACAGACCTTCAACGGG - Intronic
1071337446 10:84612376-84612398 AAGAGGAGGGGGCCCTGAGAGGG + Intergenic
1072829772 10:98645459-98645481 AGGAGGAAGGGGTCCTTAGCTGG - Intronic
1076324210 10:129608818-129608840 AAGGCGGACGGGGCCTCAGCTGG - Intronic
1076363457 10:129906496-129906518 AGGTGGAACGGGCCCTCTTCTGG + Intronic
1078161471 11:8843424-8843446 AAGAGGAACAGACTCTCAGTGGG + Intronic
1080551021 11:33374257-33374279 AAGATGAACGGCCCTGCAGCCGG - Intergenic
1083129171 11:60607549-60607571 AACAGGGAGGGGCCCTCAGAAGG - Intergenic
1084008459 11:66335165-66335187 GAGGGGACCGGGCCTTCAGCTGG + Exonic
1084735547 11:71103094-71103116 AGGAGGATGGGGCCTTCAGCAGG - Intronic
1085619988 11:78030720-78030742 CAGATGAAAGGGCCCTCAGAAGG + Intronic
1087429650 11:98036451-98036473 ATGAGGAACGGGCCCTCACCAGG + Intergenic
1088969478 11:114760299-114760321 ATGAGGAACAGGCCTTCACCAGG + Intergenic
1089695178 11:120212129-120212151 CAGAGGGAGGGGGCCTCAGCTGG - Intronic
1089936172 11:122366182-122366204 AAGTGGGACGGGACCTCAGCGGG - Intergenic
1091394268 12:143956-143978 AAGAGCAAGGGGCCTCCAGCCGG + Intronic
1100532617 12:95474309-95474331 AAGAGCAAAGGGCCTTCTGCAGG + Exonic
1102566896 12:113802916-113802938 GAGAGGCACTGGCTCTCAGCCGG + Intergenic
1111628764 13:90823242-90823264 AAGTGGACCTGGCCCTCAGCAGG + Intergenic
1112251246 13:97782501-97782523 ATGAGTAACAGGCCCTCAGCAGG + Intergenic
1113035856 13:106047813-106047835 ATCAGGAAGGGGCCCTCACCAGG + Intergenic
1113774270 13:112933865-112933887 AGGAGGAAAGGCCGCTCAGCTGG + Intronic
1114239770 14:20855789-20855811 AACAGGACCCAGCCCTCAGCAGG + Intergenic
1114737887 14:25061764-25061786 AAGAGGAAGGAGCCCTCAAAAGG + Intergenic
1116950591 14:50875150-50875172 AATAATAACGGGGCCTCAGCTGG - Intronic
1119377095 14:74203655-74203677 AGGAGGAAGGGGCCCACAGGAGG - Intergenic
1121866079 14:97364094-97364116 ATGAGGAAAGGGCCCTAAGTTGG + Intergenic
1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG + Intronic
1129061467 15:72863789-72863811 AAGAGGAAAGGGCACGCAGAGGG + Intergenic
1131006099 15:88979731-88979753 AAGTGGCACGGACACTCAGCCGG - Intergenic
1132100295 15:99018252-99018274 TAGAGGAACTGGCTCTCAGCGGG + Intergenic
1132799514 16:1744718-1744740 AAGAAGAGCGGGCCCAGAGCGGG - Intronic
1135985274 16:27179353-27179375 CAGAGGAACGGGCCTTCTCCCGG - Intergenic
1136020961 16:27439815-27439837 AGGAGGAAGGGACCCTCGGCGGG - Intronic
1136669435 16:31842851-31842873 AAGTGGCCCGGACCCTCAGCTGG - Intergenic
1138864442 16:60799179-60799201 ATGAGAAATGGGCCCTCACCAGG + Intergenic
1140481126 16:75263466-75263488 CAGAGGAAGGGGCACTGAGCAGG + Intronic
1140900692 16:79364481-79364503 AAGAGGAACGGTCCCAGAACGGG + Intergenic
1141582856 16:85011943-85011965 AAGAGGAAAGCGCCCTGAACTGG + Intergenic
1141868794 16:86770084-86770106 AAGAGTAAGGAGCCCTCAGTAGG + Intergenic
1141954432 16:87360949-87360971 AAGAGGAAGGTGCTGTCAGCAGG - Intronic
1146004885 17:29154897-29154919 ATGAGGGAAGGGCCCCCAGCAGG + Intronic
1147323872 17:39661179-39661201 AACAGGAACGCAGCCTCAGCAGG - Intronic
1148047098 17:44750870-44750892 AAGAGGAGTGGGCCCTTAACAGG - Exonic
1148478644 17:47945785-47945807 GAGAGGAACGGGGCCTGTGCTGG + Intronic
1149492861 17:57097635-57097657 AAGGGGAAGAGTCCCTCAGCAGG + Intronic
1150437253 17:65163743-65163765 GAGAGGAAGGGGCTCTCAGCAGG + Intronic
1155187089 18:23396616-23396638 AAGAAGAATGTGCTCTCAGCAGG + Intronic
1156765404 18:40648131-40648153 AGGAGGAATGGGGCTTCAGCAGG - Intergenic
1160126104 18:76173463-76173485 CAGAGGAAGGGACCCTCAGAAGG - Intergenic
1160340599 18:78085708-78085730 ATGAGGACCAGGCCCTGAGCCGG - Intergenic
1161056106 19:2191382-2191404 GAAAGGAACGGCCCCACAGCGGG - Intronic
1161396896 19:4049466-4049488 AACAGGGCCTGGCCCTCAGCGGG - Intronic
1163868075 19:19791574-19791596 AAGCGGCTCGGACCCTCAGCTGG + Exonic
1166961243 19:46497123-46497145 AAGAGCAGCTGGCCCACAGCTGG + Intronic
1167231204 19:48284780-48284802 AAAAGGAACAGGCCTTTAGCAGG - Intronic
1167371567 19:49085692-49085714 AAGAGGACCGGGCCCACCGCTGG - Intronic
1167745662 19:51350285-51350307 ATGAGGGCCTGGCCCTCAGCAGG + Intronic
1168134190 19:54339233-54339255 AAGAGGAACTGCCCCTCCCCAGG + Intergenic
1168134300 19:54339836-54339858 AAGAGGAACTGCCCCTCCCCAGG + Intergenic
927103351 2:19804781-19804803 CAAAGGAATGGGCCCTGAGCCGG + Intergenic
930673476 2:54176016-54176038 ATGAGGAACAGGCCCTTATCAGG + Intronic
935689827 2:105720994-105721016 ATGAGGAATGGGCCCCCACCAGG - Intergenic
940618654 2:156083658-156083680 AAGAGGAACCGGCAGTGAGCAGG + Intergenic
944055312 2:195516562-195516584 AAGTGGAAGGGGACCCCAGCCGG - Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
946676329 2:222163531-222163553 AAGAGCACCAGGACCTCAGCAGG + Intergenic
949043308 2:241859134-241859156 AGGAGGAAGGGGCCCTGAGCTGG - Intergenic
1169819043 20:9688563-9688585 AAGAGGAAGGGGCCATCACTGGG - Intronic
1170819223 20:19742056-19742078 CAGAGAAGCTGGCCCTCAGCTGG - Intergenic
1170830309 20:19833905-19833927 CAGGGGAATGGGACCTCAGCAGG - Intergenic
1172658615 20:36551237-36551259 AAGAGGAACGTGCTCTGGGCAGG + Exonic
1176663418 21:9661675-9661697 ATGATGAATGGGCCCTCAGCAGG - Intergenic
1177674324 21:24276435-24276457 AAAAGGAATGTGCTCTCAGCTGG - Intergenic
1177703844 21:24674543-24674565 CAGTGAAACTGGCCCTCAGCAGG - Intergenic
1179935646 21:44602087-44602109 AAGAGGCCCAGGCCCACAGCAGG - Exonic
1180201380 21:46226630-46226652 AAGAAGAACAGGCCTTGAGCAGG + Intronic
1181018607 22:20086147-20086169 AAGTTGAAGGGGTCCTCAGCAGG - Exonic
1181314173 22:21961186-21961208 AAGAGCCATGGGCCCTCGGCAGG - Intronic
1183838605 22:40478483-40478505 AAGAGGAAAAGGCCCTCCGTGGG - Intronic
1184068275 22:42132581-42132603 AGGAGGACCGGGCCCTCTACAGG + Intergenic
1184506805 22:44908563-44908585 AAGTGGCACTTGCCCTCAGCAGG - Intronic
1185213357 22:49584568-49584590 ATGAGGAACCGGCTCTCAGGAGG + Intronic
950070658 3:10149406-10149428 AAGAGGAACAGGCCCTGGCCAGG - Intronic
950264700 3:11565026-11565048 AAGAGGAATGGGCATTCAGGGGG + Intronic
952848752 3:37710832-37710854 AAGAGAAGCGCTCCCTCAGCTGG - Intronic
954799651 3:53179888-53179910 AAGAGCACCGGGCCCTGTGCTGG + Intronic
955413093 3:58668391-58668413 AAGAGGAGTGGGCCCTCAGCAGG + Intergenic
960635579 3:119781491-119781513 GAGAGGAAAGAGCCCTCAGCTGG + Intronic
962392478 3:134984561-134984583 GAGAGGGAAGGGCCCTCACCTGG + Intronic
962392490 3:134984590-134984612 GAGAGGGAAGGGCCCTCACCTGG + Intronic
962392502 3:134984619-134984641 GAGAGGGAAGGGCCCTCACCTGG + Intronic
963111335 3:141690768-141690790 AAGAGTAATGGGGCCTCAGCTGG + Intergenic
963229972 3:142899627-142899649 GTGAGGAACAGGCCCTCACCAGG - Intergenic
963900411 3:150727717-150727739 AAGAGCAACGGGAGCTCTGCAGG + Intergenic
964379899 3:156087688-156087710 AACAGCAGCGAGCCCTCAGCAGG + Intronic
965768687 3:172158050-172158072 ATGAGGAACGGGCTTTCACCAGG + Intronic
966885891 3:184378003-184378025 AAGAGAAATGGGCTCCCAGCTGG - Intronic
970438234 4:16056343-16056365 AAGAGGAGGGGGCCCTGAGAGGG + Intronic
970861022 4:20702347-20702369 AAGAGAAATTGGACCTCAGCTGG + Intronic
973787110 4:54342315-54342337 AAGAGGAACCGGCGGTGAGCTGG - Intergenic
977040673 4:92013422-92013444 AAGCGGCTCGGACCCTCAGCTGG - Intergenic
979478475 4:121186074-121186096 AAGAGGGACGGGCCCTCATGAGG + Intronic
985411884 4:189694238-189694260 ATGATGAATGGGCCCTCAGCAGG + Intergenic
985411895 4:189694308-189694330 ATGATGCATGGGCCCTCAGCAGG + Intergenic
985411913 4:189694445-189694467 ATGATGCATGGGCCCTCAGCAGG + Intergenic
986974815 5:13382260-13382282 GAGAGGGTGGGGCCCTCAGCTGG - Intergenic
986988458 5:13524921-13524943 AAGCGGCTCGGACCCTCAGCTGG - Intergenic
987779186 5:22410689-22410711 AAGAGGAATTGGCCCTCTGAAGG - Intronic
988494514 5:31733581-31733603 AAGAGGCACATGCTCTCAGCTGG + Intronic
988797607 5:34666501-34666523 TTGAGGAACTGACCCTCAGCTGG + Intronic
992161530 5:74008673-74008695 AAGAGGAAGAGGCACCCAGCAGG - Intergenic
1002758478 6:183509-183531 AAGAGGAGCGGGCAGGCAGCTGG + Intergenic
1002915625 6:1525850-1525872 GAGAGGAACAGGGCCCCAGCAGG + Intergenic
1002967205 6:1978363-1978385 AAGAGGAAAGGGCCACCACCTGG + Intronic
1005424776 6:25691121-25691143 AAGAAGAACGTGCACTCACCTGG - Exonic
1009551419 6:65098366-65098388 AAGAGAAACAGGATCTCAGCTGG - Intronic
1010762409 6:79738483-79738505 AAGAGCAAAGGGGCCTAAGCTGG + Intergenic
1016572693 6:145532641-145532663 AAGTGGCCCGGACCCTCAGCTGG + Intronic
1017503029 6:155042995-155043017 AACAGTAACTGGCACTCAGCAGG - Intronic
1017646006 6:156540729-156540751 TAGAGAATCGGCCCCTCAGCAGG - Intergenic
1017708271 6:157144679-157144701 AAGAGGAAGGGCCCAGCAGCTGG + Intronic
1019334046 7:474592-474614 AAGTGGATCGTGCCCTTAGCTGG + Intergenic
1023841070 7:44097739-44097761 GAGAGGAAGGGGCTCCCAGCAGG - Intergenic
1029515267 7:101019760-101019782 AAGAGGGACTGGGCCTGAGCTGG - Intergenic
1033829203 7:145231953-145231975 GAGAGGAAGGGAGCCTCAGCTGG - Intergenic
1035534881 8:383382-383404 AAGAGGAACGGGCTCTCCACAGG + Intergenic
1036485744 8:9177350-9177372 AAGAGGAGCGGGTGCTCAGGTGG - Intergenic
1038427174 8:27471283-27471305 GAGAGCAAAAGGCCCTCAGCAGG + Intronic
1039841837 8:41299137-41299159 AAGAGACACAGGCTCTCAGCTGG + Intronic
1040723557 8:50353986-50354008 AAGAGACATGAGCCCTCAGCAGG + Intronic
1043980515 8:86633217-86633239 ATGATGACCGGGCCCTCAGCTGG + Intronic
1046915010 8:119670663-119670685 AAGAGAAAGGGGCTTTCAGCTGG + Intronic
1048308990 8:133303752-133303774 ACGAGGAACAGGCCCTCACCAGG + Intergenic
1049746605 8:144265757-144265779 GAGAGGGAAGGACCCTCAGCAGG - Intronic
1050030226 9:1378252-1378274 GAGAGGAGCAGGCCCTCTGCAGG - Intergenic
1050993775 9:12187270-12187292 ATGAGGAACAGGCCTTCACCAGG - Intergenic
1053534690 9:38913820-38913842 ATGAGGAATGGGTCCTCACCAGG + Intergenic
1054206909 9:62138240-62138262 ATGAGGAATGGGTCCTCACCAGG + Intergenic
1054631441 9:67450107-67450129 ATGAGGAATGGGTCCTCACCTGG - Intergenic
1057477127 9:95412216-95412238 AAGTGGAAAGAGCCCTCAGAGGG + Intergenic
1059471071 9:114505229-114505251 TAGAGGAACGGGCGCCCGGCTGG - Intronic
1060826480 9:126690754-126690776 AAGAGGGAGAGGCCCTCGGCAGG + Intronic
1060858257 9:126933206-126933228 AAGAGGGACGGGGCATCATCAGG + Intronic
1062281349 9:135753271-135753293 AAGAGGAGCTGGCCATCACCAGG + Intronic
1203662680 Un_KI270753v1:60090-60112 ATGATGAATGGGCCCTCAGCAGG + Intergenic
1203670683 Un_KI270755v1:8536-8558 ATGATGCATGGGCCCTCAGCAGG - Intergenic
1203670701 Un_KI270755v1:8673-8695 ATGATGCATGGGCCCTCAGCAGG - Intergenic
1203670712 Un_KI270755v1:8743-8765 ATGATGAATGGGCCCTCAGCAGG - Intergenic
1193937636 X:87641932-87641954 AATAGGAAAGGGCCATCAGGTGG - Intronic
1201931263 Y:19352021-19352043 GAGAGGAAGGGTACCTCAGCAGG - Intergenic