ID: 1122864761

View in Genome Browser
Species Human (GRCh38)
Location 14:104598636-104598658
Sequence TGGGTTTATCCTCAGCACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122864761_1122864766 3 Left 1122864761 14:104598636-104598658 CCAACGTGCTGAGGATAAACCCA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1122864766 14:104598662-104598684 CACAGCGCCCAACTCAGAGCAGG 0: 1
1: 0
2: 3
3: 35
4: 267
1122864761_1122864769 13 Left 1122864761 14:104598636-104598658 CCAACGTGCTGAGGATAAACCCA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1122864769 14:104598672-104598694 AACTCAGAGCAGGCGACACCAGG 0: 1
1: 0
2: 1
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122864761 Original CRISPR TGGGTTTATCCTCAGCACGT TGG (reversed) Intronic
900835642 1:5001644-5001666 CAGGTTTATCTTCAGCACCTAGG + Intergenic
904894399 1:33803309-33803331 TGGGTGTTATCTCAGCACGTGGG - Intronic
905518862 1:38582189-38582211 GTGGCTTATCCTCAGCACTTTGG + Intergenic
911808080 1:102236136-102236158 TGGGTTATCCCTCAGCATGTTGG - Intergenic
913336784 1:117716096-117716118 TGGGTCCCTCCACAGCACGTGGG - Intergenic
920050108 1:203159321-203159343 GGGGTTTATCCTAAGTACGAGGG - Intronic
920783654 1:209019918-209019940 TGGATTTATCCTCAGAAAATGGG - Intergenic
921232783 1:213089873-213089895 TGAATGTATCTTCAGCACGTAGG - Intronic
923991955 1:239447950-239447972 TGGGTTTATTCTCAGCAACGTGG - Intronic
924323030 1:242868794-242868816 TGGGTTTATGCTGAACAGGTAGG - Intergenic
1064671133 10:17714858-17714880 TGTGTTTATCCTCAGCTTATAGG + Exonic
1065507169 10:26440139-26440161 TGGGTTTTTTCTCAGCACTTGGG + Intronic
1066235240 10:33479463-33479485 TGGGTCTAATCTCAGCACTTTGG - Intergenic
1066280168 10:33909494-33909516 TGGGTATATTCTCAGTACCTGGG - Intergenic
1071877430 10:89856358-89856380 TTGCATTATCCTCAGCAAGTCGG - Intergenic
1076866934 10:133171530-133171552 TGCCTTTATCCCCAGCACTTTGG - Intronic
1080114479 11:28606793-28606815 AGGGTTTCTCCTCACCACGGAGG + Intergenic
1084335941 11:68457914-68457936 TGGGTTTATGCTCAGACCATGGG - Intergenic
1085695762 11:78703258-78703280 TGCGTTTATGCTCAGCTCCTAGG - Intronic
1087233737 11:95695812-95695834 TGAGTTTATCCCCAGCACAGGGG + Intergenic
1089103932 11:115986496-115986518 TGGCTGTAACCTCAGCACTTTGG - Intergenic
1090293728 11:125568784-125568806 TGCGTGTAACCTCAGCACTTTGG - Intergenic
1095298491 12:40554875-40554897 TGGGTTTATCCTCATGACTAAGG + Intronic
1097785085 12:63750172-63750194 TGGTTTTAATCTCAGCACTTTGG - Intergenic
1101772327 12:107762448-107762470 TGGCTCTCTCCTCAGCACTTTGG + Intergenic
1103624305 12:122206653-122206675 TGCGGCTATCCGCAGCACGTGGG + Exonic
1104200130 12:126580606-126580628 AGGGTTCCTCCTCAGCACATGGG + Intergenic
1105549292 13:21377757-21377779 TGGGCTTGTCCTCAGCAGTTAGG - Intronic
1106051038 13:26189637-26189659 TAGCTTCATCCTCAGCACATTGG + Intronic
1109206109 13:59484827-59484849 TGTGTTTCTCCTCAGCAAGTGGG - Intergenic
1111427708 13:88109783-88109805 TTGGTGTATCCTCAGCACCTAGG + Intergenic
1113636228 13:111920782-111920804 GGGTTTTATCCTCAGCACCTGGG - Intergenic
1115647043 14:35375847-35375869 TGGGCTTGCCCTCAGCAAGTGGG - Intergenic
1117584942 14:57191678-57191700 TGGGTTTATTCTTAGGACTTTGG - Intergenic
1120537177 14:85711371-85711393 TGTGTGTATTCTCAGCACTTTGG - Intergenic
1120910966 14:89666325-89666347 TGTGTGTAATCTCAGCACGTTGG - Intergenic
1121661369 14:95637705-95637727 TGGGTTTATCCTCAAGATGATGG + Intergenic
1121802879 14:96789663-96789685 TGGGTTTAGCTACAGCACGGTGG + Intergenic
1122864761 14:104598636-104598658 TGGGTTTATCCTCAGCACGTTGG - Intronic
1126373462 15:47971098-47971120 TGTGTTTATCTTCAGCAAGCAGG + Intergenic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1128194354 15:65737850-65737872 TGGGTTTAACATCAGCAGATGGG - Exonic
1132866348 16:2094440-2094462 TGGGTTTATCAGCAGCAAGCGGG - Intronic
1134301404 16:12994611-12994633 TGGGCTTATTCTCAGAATGTAGG - Intronic
1134433423 16:14233525-14233547 TGGGTGTAATCTCAGCACTTTGG + Intronic
1139253740 16:65521191-65521213 TGGGTTTCTCATCAGCAAGCTGG + Intergenic
1140257166 16:73347260-73347282 TGGGAGTATCCTCAGCCCGGAGG + Intergenic
1140524692 16:75612857-75612879 TGGGTTCATTCTCTGCAGGTGGG - Exonic
1148531813 17:48400499-48400521 TGGGATTATTCTCAGCACTTCGG + Intronic
1152849013 17:82620533-82620555 AGGGTCACTCCTCAGCACGTGGG - Intronic
1153216347 18:2824471-2824493 TGGGTGTAACCCCAGCACTTTGG - Intergenic
1153969581 18:10213883-10213905 GGGGTTTGTCCTCAGCACCTGGG + Intergenic
1154093036 18:11382422-11382444 TGGGTTGATACTCAGCACAGAGG - Intergenic
1154094262 18:11396127-11396149 TGGGTATATACTCAGTACCTAGG + Intergenic
1158410524 18:57201150-57201172 TGGATGTATCCTGAGCAGGTGGG + Intergenic
927423101 2:22953454-22953476 TGGGTTCATCCTCAGGTCGAAGG - Intergenic
927640831 2:24844349-24844371 TGGCTTGGTCCTCAGCACCTAGG + Intronic
928411493 2:31057859-31057881 TGGGTTGAGCCTCAGCTGGTTGG + Intronic
929024803 2:37589691-37589713 TGGGTATATACACAGAACGTAGG + Intergenic
932482090 2:72049519-72049541 TGTGTTTAATCTCAGCACTTTGG + Intergenic
933088313 2:78085919-78085941 TGGGTATATGCTCAGAACCTTGG - Intergenic
935934089 2:108163065-108163087 TGGGTGCATCCTTAGCACTTGGG - Intergenic
937012018 2:118571554-118571576 TGGGTTTAACGTCAGCAGATGGG - Intergenic
1170746671 20:19105725-19105747 TTGATTTATTCACAGCACGTCGG + Intergenic
1172527696 20:35610283-35610305 TGGGTTTAGGCTCAGCACAGTGG + Intergenic
1173755832 20:45515329-45515351 TTGCTTTAACCTCAGCACCTAGG + Intronic
1174452593 20:50629180-50629202 TGGGTTTATTCTAAGTAGGTTGG + Intronic
1175178549 20:57128653-57128675 TGGGTTTAAGCCCATCACGTTGG - Intergenic
1177684587 21:24419348-24419370 TGGGTTTCTCCTCAGAAAATGGG + Intergenic
1177895758 21:26854968-26854990 TGGGTTCATCCTCATCAAGCTGG + Intergenic
1180183397 21:46127918-46127940 TGGGTTTATCCCGGGCACGCAGG - Intronic
1180658498 22:17445245-17445267 TGCGTGTAACCTCAGCACTTTGG + Intronic
1184595517 22:45511707-45511729 TGGGTGTAATCTCAGCACTTTGG - Intronic
1184943534 22:47785170-47785192 TGGGTTTACCCTTAGCAAGAGGG - Intergenic
950373792 3:12553325-12553347 GGGGTTTATCCTGAGCAATTGGG + Intronic
950480312 3:13239638-13239660 AGGGTTTGTCCTCAGTAAGTGGG - Intergenic
950709199 3:14802967-14802989 TGGGTTTACCCTCAACTCCTCGG + Intergenic
952817383 3:37457458-37457480 TGGGTGTTTCCTCAGCAAGACGG - Intronic
954961841 3:54572300-54572322 TGGATGTATCCCCAGCACCTAGG + Intronic
961335168 3:126171731-126171753 TGGGTTTTTCCTCATCACTTAGG - Intronic
968073453 3:195802416-195802438 TGGGTTGATCCTCAGCTCTGAGG + Intronic
971159136 4:24115407-24115429 TGGGATTTTCCTAAGCATGTAGG - Intergenic
977458321 4:97292093-97292115 TGGGTATATACTCAGCACTAGGG + Intronic
981858653 4:149327393-149327415 TGGCTCTATCCTCATCATGTAGG - Intergenic
985819154 5:2148129-2148151 TGAGTTCACCCTCAGCATGTTGG + Intergenic
990436657 5:55799321-55799343 TGGCTGTAACCTCAGCACTTTGG - Intronic
990766515 5:59189712-59189734 TGGGTGTTTCCTTAGCACGAAGG - Intronic
992994608 5:82320374-82320396 TGCCTGTATCCTCAGCACTTTGG + Intronic
993700215 5:91110261-91110283 GGGGTTTATACTCAGCTGGTAGG + Intronic
1000552249 5:162681498-162681520 TGATTTTATCCTGAGCAAGTGGG + Intergenic
1002819526 6:711602-711624 TGGGTTTTTCCGCAGCACCGTGG + Intergenic
1006301400 6:33195222-33195244 TGGGTTTTTCCTCGGCCAGTTGG + Intronic
1009198366 6:60714363-60714385 TGGGTATATACCCAGCATGTTGG - Intergenic
1012683166 6:102209258-102209280 TGGATTTCTCCTCAGAAAGTGGG - Intergenic
1018652202 6:166001997-166002019 TGGGTTTATCCTAAGGCAGTGGG + Intergenic
1020233874 7:6340637-6340659 TGGGATTATTCCCAGCACTTTGG + Intronic
1040346879 8:46511432-46511454 TTTCTTTATACTCAGCACGTTGG - Intergenic
1045869356 8:106907545-106907567 TGGCTTTAACCCCAGCACTTTGG - Intergenic
1046575931 8:116028814-116028836 TGCCTGTAACCTCAGCACGTTGG - Intergenic
1048965745 8:139613402-139613424 TGGATTTATGCTCAGCGCTTTGG + Intronic
1061406741 9:130396407-130396429 TGACTTTATCATCAGGACGTGGG + Intronic
1062612598 9:137381801-137381823 TGGGCTTCTCCTCAGCACCCAGG + Intronic
1189100139 X:38180470-38180492 TGGATTTATCATCAGTACATGGG - Intronic
1198953176 X:142096478-142096500 TGGGTTTATCCTATGAACCTGGG - Intergenic
1201700011 Y:16870420-16870442 TGGGCATAACCTCAGCACTTTGG + Intergenic