ID: 1122865247

View in Genome Browser
Species Human (GRCh38)
Location 14:104600967-104600989
Sequence CAGAGTCTGATGGGGTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122865238_1122865247 4 Left 1122865238 14:104600940-104600962 CCTAAACAGGCCCAGACCTCTAG 0: 1
1: 0
2: 3
3: 25
4: 236
Right 1122865247 14:104600967-104600989 CAGAGTCTGATGGGGTCAGTGGG 0: 1
1: 0
2: 0
3: 23
4: 196
1122865239_1122865247 -6 Left 1122865239 14:104600950-104600972 CCCAGACCTCTAGCAGCCAGAGT 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1122865247 14:104600967-104600989 CAGAGTCTGATGGGGTCAGTGGG 0: 1
1: 0
2: 0
3: 23
4: 196
1122865240_1122865247 -7 Left 1122865240 14:104600951-104600973 CCAGACCTCTAGCAGCCAGAGTC 0: 1
1: 0
2: 2
3: 13
4: 162
Right 1122865247 14:104600967-104600989 CAGAGTCTGATGGGGTCAGTGGG 0: 1
1: 0
2: 0
3: 23
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122865247 Original CRISPR CAGAGTCTGATGGGGTCAGT GGG Intronic
900542583 1:3211486-3211508 CAGAGTCTCTTGGGGCCCGTCGG + Intronic
900741647 1:4333829-4333851 CAGAGTTGGAGGGGGTGAGTGGG + Intergenic
901325713 1:8364092-8364114 AAGAGGATGATGGGCTCAGTGGG - Exonic
902780073 1:18699201-18699223 CTGAGTCTGAGGGGGACATTAGG + Intronic
903353315 1:22731088-22731110 CAGAGCCTCCTGGGGTGAGTGGG - Intronic
903481170 1:23654467-23654489 CACAGTCTGATGGGGGAGGTTGG + Intergenic
904397087 1:30229213-30229235 CAGAGAGGGATGGGTTCAGTTGG - Intergenic
904961196 1:34334396-34334418 GACAGCATGATGGGGTCAGTGGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
909907959 1:81221869-81221891 CACAGCCTGATGGGCTGAGTGGG + Intergenic
910864094 1:91771865-91771887 CACAGTTTGATGGGGGCAGAGGG + Intronic
912933998 1:113986994-113987016 CAGGCTCTGATGGGGTGAGACGG - Intergenic
914248371 1:145902106-145902128 GAGGGTCTGCTGGGCTCAGTTGG + Intronic
920900831 1:210108933-210108955 CAGAGTGTGATGGTGGAAGTGGG + Intronic
922595622 1:226810671-226810693 CAGAATGTGATGGGGTAACTTGG + Intergenic
924793052 1:247270501-247270523 CAGGGCCTGCTGGGGTCTGTGGG - Intergenic
1063724392 10:8620985-8621007 CAAAGTGTGATGGGGTGAGGTGG + Intergenic
1064163999 10:12971541-12971563 CAGAGGCTGCTGGGGACAATAGG - Intronic
1065997443 10:31071963-31071985 AAGAGTCTGATGGGAGAAGTAGG + Intergenic
1066206641 10:33195961-33195983 CAGAGTCTACTGTGGTCAGAGGG - Intronic
1070159295 10:73856058-73856080 CAGAATCTGATGGGGTGCGGTGG - Intronic
1070337326 10:75467185-75467207 CAGAGTCTGAAGCGACCAGTAGG + Intronic
1071200021 10:83211466-83211488 TAGAGGTTGATGGGGTCAGAAGG + Intergenic
1072856570 10:98953446-98953468 CAGAGTTTGATGTGGTGAGATGG - Intronic
1073070216 10:100788498-100788520 CTGAGGCTGATGGGGGAAGTCGG + Intronic
1074096486 10:110318032-110318054 CAGCGTCTGCTGGTGTCTGTCGG - Intergenic
1074891626 10:117741000-117741022 CAGAGTCTCAAGGGCTCAGTTGG - Intergenic
1075046438 10:119149943-119149965 CAGTGGCTTATGGGGCCAGTCGG + Intronic
1076167597 10:128294814-128294836 CAGAGGTTGCTGGGGACAGTGGG - Intergenic
1076712742 10:132347622-132347644 CAAAGTCAGATGTGCTCAGTGGG + Intronic
1078366618 11:10712026-10712048 CAGATTCTGATGGGGTAGGGGGG - Intergenic
1083737625 11:64690671-64690693 ATGAATCTGATGGGGTCTGTGGG - Intronic
1084890005 11:72232124-72232146 CAGCGTCTGGTGGGCTCAGCGGG + Intronic
1087388490 11:97504625-97504647 CAGAGTCGGCTGGGCGCAGTGGG + Intergenic
1088257724 11:107916670-107916692 CAGTGTCTGCTGGTGTCTGTTGG - Intronic
1090468606 11:126958026-126958048 CAGATTCTGATGAGGTCAGGTGG + Intronic
1091301839 11:134512926-134512948 CAGTGTCTGCTGGGGTGAGTCGG - Intergenic
1091682451 12:2536874-2536896 CACAGTCAGAAGGGGTCTGTAGG - Intronic
1092055595 12:5505847-5505869 CAGTGGCTGATGGGGTCTGTGGG - Intronic
1094361716 12:29638297-29638319 CAGTGTCTGCTGGGGTCTGTCGG - Intronic
1096820003 12:54226454-54226476 CAGAGGCTGGTGGGGTTGGTGGG + Intergenic
1098024515 12:66188416-66188438 TAGAGTGTGATGGGCTGAGTGGG + Intergenic
1101058354 12:100943975-100943997 CAGAGTCAGAATGGGTCAGAGGG - Intronic
1102107199 12:110335637-110335659 CAAAGTCTGTGTGGGTCAGTCGG + Intronic
1103852760 12:123943915-123943937 CACAGTCTGTTGGGGTGAGGTGG - Intronic
1107578344 13:41752256-41752278 CTGAGTCTTAAGGGGTAAGTAGG - Intronic
1107600924 13:42011887-42011909 CAGAGCCAGATGTGGGCAGTGGG - Intergenic
1107871426 13:44749801-44749823 CAGAGTCTGAGGGAGTCACTGGG + Intergenic
1108100636 13:46950715-46950737 CAGAGATTGTTAGGGTCAGTAGG - Intergenic
1109784531 13:67156488-67156510 CGGAGTTTGGTGGGGGCAGTGGG + Intronic
1113927065 13:113947498-113947520 CAGGGCCTGATGGGGCCATTAGG + Intergenic
1116933213 14:50711141-50711163 CCGAGTCTGATGTGGGCAGGTGG - Intergenic
1118373456 14:65157110-65157132 CAGAGCCCTCTGGGGTCAGTAGG - Intergenic
1120998963 14:90437607-90437629 CTGAGGCTGGTGGGCTCAGTGGG + Intergenic
1122244690 14:100394215-100394237 AAGAGTCTGCTGGGGTCACTGGG - Intronic
1122405113 14:101496281-101496303 CAGAGGCTGCAGGGGTGAGTGGG + Intergenic
1122865247 14:104600967-104600989 CAGAGTCTGATGGGGTCAGTGGG + Intronic
1124405244 15:29385920-29385942 CAGTGTCTGCTGGTGTCTGTTGG - Intronic
1125105077 15:35961465-35961487 CAGAGTCTGATTGGCTGGGTAGG + Intergenic
1125424467 15:39535246-39535268 CACAGGCTGATGCGGTCAGAGGG - Intergenic
1129901869 15:79157641-79157663 CAGATACTGATGGAGTCAGTGGG + Intergenic
1130092335 15:80831384-80831406 CAGAGCTCGATGGGCTCAGTGGG + Intronic
1130109240 15:80950911-80950933 CCGAGTCTCATGGGTGCAGTTGG - Exonic
1130834284 15:87633952-87633974 CAGAGTCTGATGGGGACCTGAGG + Intergenic
1132666322 16:1082840-1082862 CGGGGTCTGATGGCCTCAGTGGG + Intergenic
1133398407 16:5466434-5466456 CAGAGCCTGGTGGGGGCAGAGGG + Intergenic
1135103103 16:19624041-19624063 GAGAGGCTGATGGGGACAGATGG - Intronic
1140536453 16:75714284-75714306 CAGAGGCAGAAGGGGTGAGTCGG + Intronic
1141039050 16:80655815-80655837 CAGAGTCTGAGGGGCTCTGGAGG - Intronic
1141193979 16:81845789-81845811 CAAAGTCTGAGGGGGTCGGTGGG - Intronic
1143136416 17:4714968-4714990 CTGAGTCTGAGGGAGGCAGTGGG + Intronic
1144320870 17:14118063-14118085 CAGTGTCTGCTGGTGTCTGTCGG + Intronic
1146065154 17:29628932-29628954 CAGAGTTTGGTGGGGGCAGATGG - Exonic
1146207840 17:30920400-30920422 GAGAGTCAGCTGGGGTCAGGGGG - Intronic
1146276303 17:31517801-31517823 CAGAGCCTGGAGGGGTCTGTCGG + Exonic
1150227237 17:63530763-63530785 CAGAGGAGGCTGGGGTCAGTAGG + Intronic
1150273605 17:63882203-63882225 GAGAGTGGGATGGGGTCGGTAGG - Intergenic
1150629409 17:66868504-66868526 GAGAGTTTGGTGGGGTCAGCAGG + Intronic
1151047117 17:70933600-70933622 CAGAAGCTGAGGGGGTGAGTGGG + Intergenic
1151904147 17:77036629-77036651 CAGAGTGTGATGGTGTTAGATGG - Intergenic
1152088545 17:78234431-78234453 CAGAGTCAGAGGGGGCCACTGGG + Intronic
1152203139 17:78958759-78958781 CAGAGTCAGGTGGGGTGAGTAGG - Intergenic
1152927954 17:83096212-83096234 GAGAGGGTGATGTGGTCAGTGGG + Intergenic
1153435369 18:5063087-5063109 CAGAGTCTGAAGAGGACAGTTGG + Intergenic
1154163820 18:11999246-11999268 CAGGGTCTGCCGGGGTCAGGGGG + Intronic
1156546045 18:37964650-37964672 CAGCCTCTGATGGTGTCACTGGG + Intergenic
1157513191 18:48293334-48293356 TAGAGTCAGATGAGGTCATTAGG - Intronic
1159014179 18:63088321-63088343 CAGGGCCTGCTGGGGGCAGTGGG - Intergenic
1160078141 18:75697535-75697557 CACAGTCGGATGGGGTCCGAAGG - Intergenic
1160579763 18:79876849-79876871 CAGAATGTGCTGGGGTCAGGGGG + Intronic
1160898146 19:1412459-1412481 CAGAGCCAGGTGGGGTCTGTGGG + Intronic
1162962558 19:14136516-14136538 CTGGGTCCGGTGGGGTCAGTGGG + Exonic
1165490757 19:36121497-36121519 CAGAGGGGGCTGGGGTCAGTTGG - Intronic
1165797367 19:38526825-38526847 CAGAGGTTGACGGGGTCAGAAGG - Intronic
1166798918 19:45444148-45444170 GAGAGTGTATTGGGGTCAGTTGG - Intronic
1166951205 19:46429031-46429053 AAGAGTCTGAGGGGGTCATTCGG + Intergenic
1168589109 19:57618029-57618051 CAGGGACAGATTGGGTCAGTAGG + Intronic
925249092 2:2414848-2414870 CAGAGTCTGATGTAGGCTGTGGG - Intergenic
925845222 2:8028212-8028234 CAGAGTGTGATGGTGCCACTGGG - Intergenic
927944394 2:27126646-27126668 CAGGGACAGATGAGGTCAGTGGG - Intronic
928557580 2:32444126-32444148 CAGAGTCTGGGAGGGTGAGTGGG + Intronic
928644977 2:33342325-33342347 GAGAGTCTGATGAAGTCAGCAGG - Intronic
931850917 2:66249700-66249722 CAGAGTCAGATTGGGCCAGGTGG - Intergenic
933295491 2:80486018-80486040 CAGAGTCTGAGGGTGTAATTAGG - Intronic
936347903 2:111689079-111689101 CTGAGTGTGATGGGGTCAGGTGG - Intergenic
936350208 2:111706817-111706839 GAGACTCTGGTGGGGTCAGAGGG - Intergenic
936540765 2:113349116-113349138 CAGAGTCAGATGGAGACAGCAGG - Intergenic
937224163 2:120358649-120358671 CTGAGGCTGAGGGGGTCAGCAGG + Intergenic
937227373 2:120377550-120377572 CAGAGGCTGCTGGGGACAGAGGG - Intergenic
937704979 2:124910028-124910050 GAGAGGCTGATGGGGTCAAATGG - Intronic
938109270 2:128553203-128553225 CAGAATCTGAGGAGGGCAGTGGG - Intergenic
938540399 2:132280174-132280196 CAGGGAGTGATTGGGTCAGTGGG - Intergenic
939001632 2:136742551-136742573 CAGCTTCTGATGGGTTCATTGGG + Intergenic
940231550 2:151458897-151458919 CATATTCTGATGGAGTAAGTTGG + Exonic
940374945 2:152947235-152947257 AAGAGTCTGAAGGGGTCTGAGGG + Intergenic
944097712 2:195988102-195988124 TAGAGTCTGAGGTGCTCAGTAGG + Exonic
945578737 2:211565686-211565708 CAGTGTTTGATGGGGTATGTGGG + Intronic
945906371 2:215598167-215598189 CAGAGTATAATGGTGTCATTAGG - Intergenic
948931153 2:241133296-241133318 CAGAGTCAGATGGGAGCTGTTGG - Intronic
1169426291 20:5500053-5500075 CAGAGTTTGATGTGGCCAATGGG - Intergenic
1170855015 20:20044304-20044326 CAGATTCTGTTCGGGCCAGTGGG - Intronic
1173522995 20:43712800-43712822 CAGAGTCTAATGGGGCCATGGGG + Intronic
1173635552 20:44553828-44553850 CTGAGTCTGGTGGGGTGAGTAGG + Intronic
1174093199 20:48066632-48066654 CAGAGTGAGGTGGGGTCAGAAGG + Intergenic
1175199396 20:57267144-57267166 CAGCGTCTGATGGGGGCGGGAGG - Intergenic
1177566246 21:22825579-22825601 CAGAGGCTGAGGGCATCAGTGGG + Intergenic
1178396493 21:32247948-32247970 TAGAGTCTGTTTGGTTCAGTTGG - Intergenic
1181577296 22:23803104-23803126 CACGGTCTAATGGGGACAGTTGG - Intronic
1183544944 22:38450459-38450481 CAGAGCCTGGTGAGGTCAGTGGG - Intronic
1184371180 22:44083072-44083094 TAGAGGCTGATGGGCTCAGGAGG - Intronic
1184417607 22:44361328-44361350 CAGAGCCTGACGGTGCCAGTCGG - Intergenic
1184525998 22:45023204-45023226 CAGGGTCTGCGGGGGGCAGTGGG - Intergenic
1184920309 22:47600997-47601019 CAGAGGCTGAGGGGGGCGGTGGG - Intergenic
950545332 3:13634780-13634802 CAGAGTCTGAGGCGGTCCGGGGG + Intronic
950707958 3:14794612-14794634 CAGAGGTTGATGAGTTCAGTGGG - Intergenic
951097698 3:18650950-18650972 CAGAATCTGTTGGTGTCTGTCGG - Intergenic
953406083 3:42660457-42660479 CAGAGGCTGCTGGGGTAAGCAGG + Intronic
955353973 3:58215292-58215314 AAGACCCTGATGGGGTCAGGAGG - Intergenic
958584343 3:96068235-96068257 CACAGTCTGCTGGGCTGAGTAGG - Intergenic
958685902 3:97393734-97393756 CAGAGTCTGAAGAGGGTAGTGGG - Intronic
959653842 3:108778681-108778703 CACAGTCAGAGGGGCTCAGTAGG - Intergenic
959883771 3:111475440-111475462 CAAAGGCTGGTGGGGTCAGTGGG - Intronic
960177968 3:114539748-114539770 CAGAGTCTAATGAGGGCAGTGGG - Intronic
960824943 3:121772684-121772706 CAATGTCAGATGTGGTCAGTAGG - Exonic
961505902 3:127370334-127370356 CAGGGTCTGGTGGGGTGTGTGGG - Intergenic
967530883 3:190547919-190547941 CAGGGTCTGATGGAGTAAGGGGG + Intronic
967640642 3:191858598-191858620 CAAAGTCTAATGGGGTCTCTGGG + Intergenic
969366068 4:6694816-6694838 CAGAGTCTGGTGGGGCCCGAAGG - Intronic
969595881 4:8149045-8149067 CAGAGTGTGAAGGGGTCTGTAGG + Intronic
972104380 4:35463398-35463420 CAGTGTCTGCTGGTGTCTGTCGG - Intergenic
975421477 4:74169056-74169078 CGGTGACTGATGGAGTCAGTTGG + Intronic
975446112 4:74467575-74467597 CAGAATTTGATGGGGTAAATAGG - Intergenic
977605868 4:98984580-98984602 CAGTGCCTGGTGGGGTCAGGAGG - Intergenic
977685011 4:99837408-99837430 TAGAGGGTGATGGGGTAAGTAGG + Intronic
979725595 4:123956581-123956603 CTGAGTATGATGGGCTAAGTAGG + Intergenic
981265429 4:142777529-142777551 CAGAGGCTCAGGGTGTCAGTAGG - Intronic
982002676 4:151035597-151035619 CAGTTTCTGATGGGGGAAGTGGG + Intergenic
982727680 4:158922320-158922342 CAGAGTGAGAAGGGGTCTGTTGG - Intronic
984877718 4:184384585-184384607 CAGTGTCCCATGGGGCCAGTGGG + Intergenic
985860616 5:2467838-2467860 CAGGGTCTGTTGGGGGCAGCAGG - Intergenic
986089490 5:4489776-4489798 CCGAGTCTGCAGGTGTCAGTTGG + Intergenic
987441842 5:17966736-17966758 CACAGTCTGTTGGGATGAGTTGG - Intergenic
988852150 5:35190746-35190768 CAGAATAAGATGGGCTCAGTAGG - Intronic
991092471 5:62706386-62706408 GAGGGTCTGATGGGGCCACTTGG - Intergenic
992377544 5:76203279-76203301 CAGAGTTTGATTGGGTGAGGGGG + Intronic
992608386 5:78485453-78485475 CCAAGGCTGAGGGGGTCAGTAGG - Exonic
993670556 5:90756271-90756293 TAGATTCTGAAGTGGTCAGTGGG + Intronic
994282355 5:97920994-97921016 TAGAGTCAGGTGGGGTCAGTTGG + Intergenic
997379507 5:133425567-133425589 CAGAGTCTTGGGAGGTCAGTTGG - Intronic
997384119 5:133459055-133459077 CAGAGGCAGGTGGGGTCTGTTGG - Intronic
997393811 5:133540156-133540178 CAGAATCTGATGGGGTAAGCTGG - Intronic
999683858 5:154084992-154085014 CAGCCTCTGATAGGGTCAGCAGG + Intronic
999936995 5:156497826-156497848 CAGACACTGATGGGGTCATCTGG + Intronic
1001052633 5:168425270-168425292 CAGAGCCAGATGGGGTTGGTGGG - Intronic
1001441866 5:171749733-171749755 CAGAGCCTCGTGGGGTCTGTGGG - Intergenic
1001703061 5:173721338-173721360 CACAGCCTGATGTGGTGAGTGGG - Intergenic
1001818628 5:174692459-174692481 CAGAGCCTAATGAGGTCATTAGG + Intergenic
1002309827 5:178307590-178307612 CAGGGTCTGATGTGGGCAGAGGG - Intronic
1002908526 6:1470412-1470434 TAGAGTATGTTGGTGTCAGTAGG - Intergenic
1004009347 6:11667135-11667157 CTAATTCTGATGGGGCCAGTTGG - Intergenic
1004344782 6:14838857-14838879 GAAATTCTGATGGGGTCAGCGGG + Intergenic
1006440022 6:34048201-34048223 CAGGGTCTGGTGGGGCCAGCTGG + Intronic
1006917132 6:37601959-37601981 TAGACTCTGATGGGGGCAGCTGG + Intergenic
1008505392 6:52225133-52225155 CAGGGTCTGATGGGGCCAATGGG - Intergenic
1009903189 6:69834588-69834610 CAGTGTATGGTTGGGTCAGTTGG + Intergenic
1013059719 6:106621431-106621453 CAGAGTTTGTTGTAGTCAGTGGG - Exonic
1016072820 6:139761074-139761096 CCGAGTATGTTGGGGTCACTGGG - Intergenic
1019800483 7:3084689-3084711 CAGCGTCTGCTGGTGTCTGTTGG - Intergenic
1023491803 7:40751067-40751089 TAGAGAATGATGGGGTCAGATGG + Intronic
1024822541 7:53350200-53350222 CAGAGCCTGCTGGGGTGGGTCGG - Intergenic
1025733992 7:64131088-64131110 CAGATTCTGAGGAGGTCACTGGG - Intronic
1033041568 7:137923972-137923994 CAAAGTCACATGGGGTAAGTGGG - Intronic
1033643663 7:143285432-143285454 CAGAGTCAGACAGGGTAAGTGGG + Exonic
1034763567 7:153696342-153696364 CAGAGTCTGCTGGTGCCTGTCGG - Intergenic
1037302564 8:17468320-17468342 GAGACTGTGATGGGGCCAGTTGG + Intergenic
1037889805 8:22617953-22617975 CAGTGTCTGTTGGGGTGAATGGG + Intronic
1041415335 8:57601859-57601881 AGGACTCTGATGTGGTCAGTTGG + Intergenic
1049163485 8:141112262-141112284 CGGAGGCTGAGGGGGTCAGGTGG + Intergenic
1049368860 8:142253921-142253943 CAGGGTCTGGAGGGATCAGTGGG - Intronic
1051984768 9:23070735-23070757 CAGAGGCTGAGGTGGCCAGTGGG + Intergenic
1053442318 9:38126654-38126676 CAGTGTCTGATGTGGCCAGGTGG + Intergenic
1055501604 9:76906971-76906993 CAGATTCTGATTTGGTAAGTAGG - Intergenic
1055938883 9:81630061-81630083 CAGAGACTGATGGGATCCGCAGG - Intronic
1056637414 9:88342759-88342781 AAGAGCAGGATGGGGTCAGTAGG + Intergenic
1056756400 9:89384791-89384813 GAGAGCCTGATGGGGTCAGGCGG + Intronic
1059343420 9:113612531-113612553 CAGCTTCTGCTGGGGTCAGGAGG + Intergenic
1059457077 9:114406463-114406485 CAGAGGGTGATGGGGGCAGAAGG + Exonic
1059535192 9:115074052-115074074 CAGACTCCGATGGGGTCATGTGG - Intronic
1059641644 9:116222681-116222703 CAGAGGCAGGTGGGGTGAGTGGG + Intronic
1061034817 9:128107615-128107637 GAGGGTCTGCTGGGGTCAGCAGG - Exonic
1061134557 9:128725880-128725902 CAGGATCTGATGTGCTCAGTGGG + Intergenic
1062523366 9:136968758-136968780 CAGAGACTGCTGGGCCCAGTGGG + Intergenic
1187797946 X:23024818-23024840 CAGAATCTGATGAGGTAAGCAGG - Intergenic
1188091146 X:25967271-25967293 CAGAGTCTGATGCAGCCATTGGG - Intergenic
1191029946 X:55959002-55959024 AACAGTCTGATGGAGTCTGTTGG - Intergenic
1193150275 X:78117704-78117726 CAGACTCTCATGCTGTCAGTAGG + Intronic
1194068278 X:89288446-89288468 CAGAGTTTGGTTGGGGCAGTTGG - Intergenic
1194211289 X:91072426-91072448 CAGAGTTTGGTAGGGTCAGTTGG - Intergenic
1196264046 X:113620394-113620416 CAGAGGCTGATATGGGCAGTTGG + Intergenic
1200722421 Y:6622615-6622637 CAGAGTTTGGTTGGGGCAGTTGG - Intergenic