ID: 1122865307

View in Genome Browser
Species Human (GRCh38)
Location 14:104601261-104601283
Sequence CTGAGTCTGCACAGGTATCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122865298_1122865307 20 Left 1122865298 14:104601218-104601240 CCTGACATGGCAAGTCTGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1122865307 14:104601261-104601283 CTGAGTCTGCACAGGTATCGGGG 0: 1
1: 0
2: 0
3: 3
4: 112
1122865296_1122865307 29 Left 1122865296 14:104601209-104601231 CCAGAACTTCCTGACATGGCAAG 0: 1
1: 0
2: 0
3: 8
4: 159
Right 1122865307 14:104601261-104601283 CTGAGTCTGCACAGGTATCGGGG 0: 1
1: 0
2: 0
3: 3
4: 112
1122865302_1122865307 -7 Left 1122865302 14:104601245-104601267 CCTGTTGGCCAGATAACTGAGTC 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1122865307 14:104601261-104601283 CTGAGTCTGCACAGGTATCGGGG 0: 1
1: 0
2: 0
3: 3
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122865307 Original CRISPR CTGAGTCTGCACAGGTATCG GGG Intronic
900118294 1:1037941-1037963 CTGAGTCTCCACAGGCCTAGGGG - Intronic
900842959 1:5070558-5070580 AGGAGTCTGATCAGGTATCGAGG - Intergenic
903954307 1:27014214-27014236 CTGGGTCTGCATAGGTACAGTGG - Intergenic
904498986 1:30903253-30903275 CTGAGTCTGCAGAGGTGACCAGG - Intronic
909377902 1:74961170-74961192 CTGCTTCTGCACAGGGATCTGGG + Intergenic
909383911 1:75034783-75034805 CTGTGGCTGCACTGGTATCCAGG - Intergenic
910654269 1:89604151-89604173 CTGAGGTTGCACAGGTATAAAGG + Intergenic
911242414 1:95480356-95480378 CTGAGTCTGCAGAGTCATCCAGG + Intergenic
911746107 1:101443308-101443330 CACATTCTGCACAGGTATCCTGG + Intergenic
911999448 1:104812424-104812446 CTCAGTCTGCCCAGGGATCTAGG + Intergenic
912253584 1:108036254-108036276 CTCAGTCTCCACAGGTACCCAGG + Intergenic
915244234 1:154544860-154544882 CAGAGACTGCACAGGGATGGTGG - Exonic
917534320 1:175863454-175863476 CTCTGTCTGCAGAGGTATCAAGG - Intergenic
918825328 1:189316575-189316597 CTGACTCTGCCCAGGTCTCTTGG - Intergenic
919736371 1:200954686-200954708 TTGAGTCTGCACAGGTAGGCTGG - Intergenic
1069083764 10:64115936-64115958 TTGAGTCTGCAAAGGTTTCTAGG + Intergenic
1069906922 10:71737553-71737575 CTGACTCTGCACAGGACTCATGG - Intronic
1070137289 10:73706132-73706154 CTGAGAGTGTACAGGAATCGAGG + Intergenic
1075060916 10:119256219-119256241 CAGAGTCTCCACAGGAGTCGAGG - Intronic
1076581275 10:131513570-131513592 CTGAGGCTGCACAGGGCTAGGGG - Intergenic
1076776023 10:132698816-132698838 CTCAGCCTGCACAGCTCTCGTGG - Intronic
1077709498 11:4521973-4521995 CTGAGGCTGAAGAGGTATCCCGG - Intergenic
1082761391 11:57130387-57130409 CTGAGTCTGGACTGGTATGCAGG + Intergenic
1084889398 11:72229217-72229239 CGGAGGCTGCACAGGTATCTGGG + Exonic
1091147145 11:133289876-133289898 CTGGGTCTGCACAGGTGCTGGGG + Intronic
1091285583 11:134406917-134406939 CTGAGCCTGCACAGGTGTTTTGG - Intronic
1091285592 11:134406975-134406997 CTGAGCCTGCACAGGTGTTTTGG - Intronic
1092217449 12:6693281-6693303 CTGATTCTGCACAGCTTTTGGGG + Intergenic
1093908286 12:24717325-24717347 CTGAGTCTGATTAGGTATAGAGG + Intergenic
1099713406 12:86259297-86259319 ATCAGTCTGCACATGTATCTGGG + Intronic
1100158025 12:91824515-91824537 CTGAGTCTGCACAGATGTGTAGG + Intergenic
1100600476 12:96108176-96108198 TGGAGTCTGCTCAGTTATCGAGG - Intergenic
1100863910 12:98835399-98835421 CTGAGGGTGCACAGGAATCCTGG + Intronic
1102064232 12:109959680-109959702 CACATTCTGCACAGGTATCCCGG + Intronic
1102267651 12:111501484-111501506 CTGAGGCTGAAGAGGTATCTTGG - Intronic
1104374715 12:128254235-128254257 CACAATCTGCACAGGTATCCTGG + Intergenic
1105286644 13:19009513-19009535 CTGAGTTTCCACCGGTAGCGGGG - Intergenic
1105688617 13:22813373-22813395 CTGAAGCTGCACAGTTATTGTGG + Intergenic
1107853359 13:44591766-44591788 CTGAGTCTGCAAGGGCATGGGGG - Intergenic
1112338165 13:98531643-98531665 CTGAGTCAGCACTGGTATGAAGG - Intronic
1113734856 13:112671276-112671298 ATGGTTCCGCACAGGTATCGGGG - Intronic
1116169780 14:41385382-41385404 CTTAGTCAGGACAGGTATCAGGG + Intergenic
1122865307 14:104601261-104601283 CTGAGTCTGCACAGGTATCGGGG + Intronic
1126276082 15:46882962-46882984 CACATTCTGCACAGGTATCTCGG + Intergenic
1128516679 15:68346410-68346432 CTGTGTCTGCCTAGGAATCGGGG - Intronic
1128678507 15:69629209-69629231 CTGCCTCTGCACAGGTCTTGGGG + Intergenic
1138352765 16:56354867-56354889 CTGCGTCTTCATAGGTATTGGGG - Intronic
1140065365 16:71606767-71606789 CTGAGTCTTCACAGGGCTTGAGG - Intergenic
1140909520 16:79438652-79438674 CTAAGTCTGCACAGCCAGCGAGG + Intergenic
1141606091 16:85154181-85154203 CTGAGGCTGGACAGGTGACGAGG + Intergenic
1142364832 16:89644757-89644779 CTGAGGCTGCAGTGGTGTCGTGG - Exonic
1142915590 17:3133865-3133887 CTGAGACTCCAGAGGTGTCGTGG - Intergenic
1151677506 17:75606180-75606202 CAGAGGCTGCACGGGTATGGGGG - Intergenic
1151815523 17:76469671-76469693 CTGACGCTGCACAGGTCTGGGGG + Exonic
1152494992 17:80664699-80664721 CTGAGTCTCCAAAGGAATCATGG + Intronic
1152780149 17:82223979-82224001 GTGCGTCTGCACAGGTGTAGGGG - Intergenic
1153045708 18:854067-854089 CTGAGTCTGCTCAAGTGTCTTGG + Intergenic
1153168914 18:2293118-2293140 CTGGCTCTGCACTGGTACCGGGG + Intergenic
1154459810 18:14570828-14570850 CTGAGTCTGCAGATGAATGGAGG + Intergenic
1158421019 18:57294358-57294380 CTGTGTCTACACAGGTCTCAAGG - Intergenic
1158627275 18:59082170-59082192 CTCAGTTTGCACACGTATCCTGG - Intergenic
1163377525 19:16942631-16942653 CTGAGTCAGCAGAGGTTTCTTGG - Intronic
1166033154 19:40148077-40148099 CGGAGTCTGCAGAGGTTTGGAGG + Intergenic
1166424003 19:42659822-42659844 CTAAGTCTGCACAGGAATTAGGG + Intronic
1168435246 19:56311688-56311710 CACAGCCTGCACATGTATCGTGG - Intronic
930217480 2:48711365-48711387 CTGAGTCTGCAATGGTAGAGAGG - Intronic
930774916 2:55161984-55162006 CTGGGTCTGCATAGGGAGCGAGG - Intergenic
935405480 2:102704824-102704846 GTGAGTGTTCACAGGTATTGTGG + Intronic
937260034 2:120579473-120579495 CTAAGTCTGCACAGGGAGCTGGG - Intergenic
941820657 2:169840940-169840962 CTGAGGCTCCACAGGTACCCTGG + Intronic
946126222 2:217565504-217565526 CTGAGGCTGCCCAGGTAACTCGG - Intronic
946267694 2:218561908-218561930 CTGTGTATGCAAAGGTATAGTGG - Intronic
1170803404 20:19609429-19609451 CACAGTCTGCACATGTATCCTGG - Intronic
1171202266 20:23251570-23251592 CTGAGACTTCACAGGTAGCTGGG - Intergenic
1173821997 20:46025605-46025627 CTGAGTCTGCAGAGGAATGAGGG + Intronic
1174295244 20:49540889-49540911 CTTTGTCTGCACAGGGATCCAGG - Intronic
1184379189 22:44134420-44134442 CTGAGCCTGCACAGGGCTCCTGG - Intronic
1185092757 22:48785200-48785222 CTGAGTCTGCACAGCCCTGGAGG - Intronic
949512526 3:4779340-4779362 CAGATTCTGCACACGTATCTGGG + Intronic
950755198 3:15165148-15165170 CTGAGGCTGCAGAGGGATTGAGG - Intergenic
951856504 3:27203017-27203039 CTCAGTCTGAACAGGTACTGAGG + Intronic
970160621 4:13185348-13185370 CTCATTCTGCACATGTATCCTGG - Intergenic
977308666 4:95356940-95356962 CTGAGATTGCACAGGTATTAAGG + Intronic
978285721 4:107074117-107074139 CTGAGCCAGCACTGGTACCGAGG + Intronic
979673543 4:123386001-123386023 TTGAGTGTGCAAAGGTATAGAGG - Intergenic
979750910 4:124277691-124277713 CTGAGTGTGGACAGGCATGGTGG - Intergenic
981105365 4:140874762-140874784 TAGAGGCTGCACAGGTGTCGTGG - Intronic
986040379 5:3988389-3988411 CTGAAGCTGCACAGGCATGGGGG + Intergenic
995011420 5:107260423-107260445 CTGAGGCTGGACAGGTGTTGGGG + Intergenic
997359322 5:133284563-133284585 CTGTGTCTGCACAGGTTGAGTGG - Intronic
998277652 5:140773438-140773460 CACATTCTGCACATGTATCGTGG - Intergenic
1000262423 5:159600501-159600523 CTTAGGCTGCACAGGGATCAGGG + Intergenic
1002087451 5:176784982-176785004 CTGAGTCTGGAGAGGCACCGCGG - Intergenic
1006163522 6:32051196-32051218 CTGAGTATCCACAGGTAGGGTGG + Intronic
1006979061 6:38131942-38131964 CTGAGGCTGCACATGTACCCTGG - Intronic
1017682271 6:156876370-156876392 CTGAGCCTACACAGATATCGAGG - Intronic
1018787943 6:167122678-167122700 CTGTGGCTGCACAGCTTTCGGGG + Intergenic
1019064471 6:169285170-169285192 CTGATTCTGCAGAGGAATCCTGG + Intergenic
1019896674 7:3988523-3988545 CCGAGGCTGCACAGGGAGCGAGG - Intronic
1020458844 7:8405385-8405407 CACATTCTGCACATGTATCGCGG - Intergenic
1034549153 7:151809291-151809313 CTGATTCTGCACCCGTCTCGGGG - Intronic
1035902923 8:3477534-3477556 ATGAGTCTGCCCAGGTACCCAGG - Intronic
1038668605 8:29563144-29563166 TAGAGTCTGCACAGGTATGTGGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1041494388 8:58469614-58469636 CTGAGGCTGCACAGGTGGGGTGG - Intergenic
1044949386 8:97420476-97420498 CTGAGTCTGCACTGGAACCGAGG + Intergenic
1045185853 8:99837338-99837360 CTGAGGCTGCACAGATCCCGCGG - Intronic
1049774732 8:144399033-144399055 CTGAAACTGCACAGGACTCGGGG + Exonic
1053287024 9:36856142-36856164 CTCAGTCTGCATTGGTATTGTGG - Intronic
1056315057 9:85380370-85380392 CTGTGTCTGCACATGGATGGAGG + Intergenic
1062024465 9:134333898-134333920 CTGAGCCTGCACAGGTGGAGAGG - Intronic
1185456816 X:314881-314903 ATGCCGCTGCACAGGTATCGTGG - Exonic
1189011785 X:37053307-37053329 CTGAGGCTGCACAGGTTACTGGG - Intergenic
1189036924 X:37502979-37503001 CTGAGGCTGCACAGGTTACTGGG + Intronic
1191650372 X:63530177-63530199 CTGAGTCAGCACAGTCATGGTGG + Intergenic
1197319722 X:125012314-125012336 CTCATTCTGCACATGTATCCTGG + Intergenic