ID: 1122865414

View in Genome Browser
Species Human (GRCh38)
Location 14:104601808-104601830
Sequence CCCGGACCTGACCTCCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122865407_1122865414 -1 Left 1122865407 14:104601786-104601808 CCCTTCCTGACAGCAGGAGCTGC 0: 1
1: 0
2: 2
3: 32
4: 301
Right 1122865414 14:104601808-104601830 CCCGGACCTGACCTCCAGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 136
1122865403_1122865414 10 Left 1122865403 14:104601775-104601797 CCGCCACAGGCCCCTTCCTGACA 0: 1
1: 0
2: 6
3: 48
4: 336
Right 1122865414 14:104601808-104601830 CCCGGACCTGACCTCCAGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 136
1122865406_1122865414 0 Left 1122865406 14:104601785-104601807 CCCCTTCCTGACAGCAGGAGCTG 0: 1
1: 0
2: 5
3: 33
4: 332
Right 1122865414 14:104601808-104601830 CCCGGACCTGACCTCCAGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 136
1122865402_1122865414 21 Left 1122865402 14:104601764-104601786 CCTGAAATGCTCCGCCACAGGCC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1122865414 14:104601808-104601830 CCCGGACCTGACCTCCAGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 136
1122865408_1122865414 -2 Left 1122865408 14:104601787-104601809 CCTTCCTGACAGCAGGAGCTGCC 0: 1
1: 0
2: 2
3: 36
4: 363
Right 1122865414 14:104601808-104601830 CCCGGACCTGACCTCCAGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 136
1122865410_1122865414 -6 Left 1122865410 14:104601791-104601813 CCTGACAGCAGGAGCTGCCCGGA 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1122865414 14:104601808-104601830 CCCGGACCTGACCTCCAGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 136
1122865404_1122865414 7 Left 1122865404 14:104601778-104601800 CCACAGGCCCCTTCCTGACAGCA 0: 1
1: 0
2: 2
3: 40
4: 358
Right 1122865414 14:104601808-104601830 CCCGGACCTGACCTCCAGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122865414 Original CRISPR CCCGGACCTGACCTCCAGTG GGG Intronic
901086207 1:6613753-6613775 CCCCGACCTGACGCCCAGTTCGG - Exonic
914754308 1:150554146-150554168 CCCAACCCCGACCTCCAGTGTGG + Intronic
914990962 1:152499425-152499447 CCCGGCCCTGACCCAGAGTGGGG + Intergenic
915625561 1:157112078-157112100 CCCCGACCCGAACTCCAGAGAGG + Intergenic
916069094 1:161159663-161159685 CCCGTACCTGTCCCCCAGTGAGG - Exonic
920646259 1:207806465-207806487 CCAGGCCCTGAGCCCCAGTGTGG + Intergenic
923197356 1:231681522-231681544 CCTGGACCTGACCACCAGGGAGG - Intronic
923264461 1:232300858-232300880 GCAGGACCTGAGCTCCCGTGAGG + Intergenic
923622232 1:235588349-235588371 CCTGGACCTGGCCCCCAGCGGGG + Intronic
1065236851 10:23660680-23660702 CCTGGGACTGTCCTCCAGTGTGG - Intergenic
1069757325 10:70781349-70781371 CCTGGAGCTGACCTCCAGTGGGG - Intronic
1070815420 10:79319727-79319749 CCCTGACCTGACCCACAGGGAGG - Intergenic
1071882590 10:89915728-89915750 CCCTGACCTGCCCTACAGTGTGG + Intergenic
1073101209 10:101007581-101007603 CCCGGCCCTGTCCCCCAATGTGG - Exonic
1073399054 10:103241873-103241895 CCTGGGCCTGACTTCCAGGGAGG + Intergenic
1076680060 10:132167232-132167254 CCGGGTCCTGACCCCCAGGGAGG - Intronic
1076698482 10:132258150-132258172 CCCTGACCTGACCTAGAGAGGGG + Intronic
1080451300 11:32381106-32381128 CATGGGCCTGACCTCCAATGAGG + Intergenic
1085473418 11:76772898-76772920 TCCTGCCCTGACCTCCAGTCGGG + Intergenic
1087316981 11:96614759-96614781 CCTGGCCCTGACCCCCTGTGGGG - Intergenic
1090442553 11:126736602-126736624 CCTGCTCCTGGCCTCCAGTGAGG + Intronic
1096111607 12:49032160-49032182 CCAGGACCTGTCCTCCAGTCTGG - Exonic
1101857140 12:108453162-108453184 CCCCATCCTGACCACCAGTGGGG + Intergenic
1102251342 12:111389620-111389642 CCTGGACCTGCCTTCCAATGTGG - Intergenic
1103009129 12:117444514-117444536 CCTGGAGCTGAGCTCCACTGTGG + Intronic
1113536168 13:111067664-111067686 ACCGGACCTGCCCTCCAGGGCGG + Intergenic
1118597161 14:67444708-67444730 CTCTGTCCTGACCTCCAGGGAGG + Intergenic
1118821520 14:69349196-69349218 CTCGGCCCTGCCCTGCAGTGGGG + Intronic
1119205233 14:72789005-72789027 CCCAGTCCAGCCCTCCAGTGAGG + Intronic
1119784883 14:77305674-77305696 GCAGAAGCTGACCTCCAGTGTGG - Intronic
1122865414 14:104601808-104601830 CCCGGACCTGACCTCCAGTGGGG + Intronic
1202904461 14_GL000194v1_random:60231-60253 CCCGGACCTGACCTCTCCCGTGG + Intergenic
1124658939 15:31529604-31529626 CCCAGGCTTGACCTGCAGTGAGG - Intronic
1127731574 15:61807003-61807025 CCTTGCACTGACCTCCAGTGAGG + Intergenic
1127812914 15:62580063-62580085 CCAGGCCCTGGCCTGCAGTGGGG + Intronic
1130210042 15:81914449-81914471 CCAGGCTCTGACTTCCAGTGGGG - Intergenic
1130859676 15:87875196-87875218 CCGGGAGGTGAGCTCCAGTGTGG + Intronic
1132051274 15:98609659-98609681 CCTGGGCCCCACCTCCAGTGTGG - Intergenic
1138524353 16:57593295-57593317 CCCTCACCTGACCTGCAGTGTGG - Intergenic
1138830354 16:60367469-60367491 CCCACCCCTGACCTCCAGGGAGG + Intergenic
1139938233 16:70586690-70586712 CCTGGACCTGTCCTCCAGCCTGG + Intronic
1141640084 16:85335856-85335878 TTCAGACCTGACGTCCAGTGTGG + Intergenic
1141932934 16:87217609-87217631 CACGGACCTGACCCCCAGCACGG + Intronic
1141932945 16:87217645-87217667 CACGGACCTGACCCCCAGCACGG + Intronic
1141932967 16:87217717-87217739 CACGGACCTGACCCCCAGCACGG + Intronic
1141932990 16:87217789-87217811 CACGGACCTGACCCCCAGCACGG + Intronic
1141933009 16:87217844-87217866 CACGGACCTGACCCCCAGCACGG + Intronic
1141933033 16:87217917-87217939 CACGGACCTGACCCCCAGCACGG + Intronic
1141933073 16:87218029-87218051 CGCGGACCTGACCCCCAGCACGG + Intronic
1141933079 16:87218047-87218069 CACGGACCTGACCCCCAGCACGG + Intronic
1141933102 16:87218121-87218143 CTCGGACCTGACCCCCAGCACGG + Intronic
1141933108 16:87218139-87218161 CACGGACCTGACCGCCAGCACGG + Intronic
1141933119 16:87218176-87218198 CACGGACCTGACCCCCAGCACGG + Intronic
1141933125 16:87218194-87218216 CACGGACCTGACCCCCAGCACGG + Intronic
1141933138 16:87218231-87218253 CGCGGACCTGACCCCCAGCATGG + Intronic
1141933153 16:87218285-87218307 CACGGACCTGACCCCCAGCATGG + Intronic
1141933166 16:87218322-87218344 CGCGGACCTGACCCCCAGCACGG + Intronic
1141933177 16:87218359-87218381 CTCGGACCTGACCCCCAGCACGG + Intronic
1141933196 16:87218414-87218436 CACGGACCTGACCCCCAGCACGG + Intronic
1141933213 16:87218469-87218491 CACGGACCTGACCCCCAGCACGG + Intronic
1141933254 16:87218598-87218620 CGCGGACCTGACCCCCAGCACGG + Intronic
1141933282 16:87218689-87218711 CGCGGACCTGACCCCCAGCACGG + Intronic
1141933296 16:87218743-87218765 CACGGACCTGACCCCCAGCACGG + Intronic
1142175513 16:88643324-88643346 CCCGGACCTGCCCTCCCGCCAGG - Exonic
1142973715 17:3630503-3630525 CCTGGGCCTGCCCTCCACTGGGG + Intronic
1143498528 17:7325814-7325836 CCAGGACCTGTCCTCCAGGGTGG - Intronic
1145994270 17:29096587-29096609 CCCCCTCCTGACCTCCAGGGTGG - Intronic
1147204267 17:38825315-38825337 CCCGGAAGTGACCTCTAGAGCGG - Exonic
1152287958 17:79423371-79423393 CCCCAACCCTACCTCCAGTGTGG + Intronic
1156396356 18:36703618-36703640 GCAGGACCTGATGTCCAGTGAGG + Intronic
1160432823 18:78823616-78823638 CCAAGACCTGCCCTTCAGTGGGG + Intergenic
1160937477 19:1603872-1603894 CCCCGACCTGTCCCCCAGTCTGG + Intronic
1161054676 19:2184404-2184426 CCAGGACCTGACCTCAGGTCCGG - Intronic
1161273831 19:3404604-3404626 CCCGGCCCTGCCCTCCTGGGTGG - Intronic
1163536478 19:17879673-17879695 CCCGGATCTGACCTCCAGGGAGG - Intronic
1164925214 19:32124812-32124834 GCCGGTCCTGGCCACCAGTGTGG - Intergenic
1165774529 19:38396809-38396831 CACAGACCTGGCCTCCAGTCCGG + Intergenic
925380172 2:3419137-3419159 TCAGGACATGACCTACAGTGAGG - Intronic
928095249 2:28400773-28400795 CACGGACCTGCCCTCCAGAGCGG + Intronic
928397716 2:30955728-30955750 ACCGGACCAGACCTGCAGTCAGG + Exonic
932211943 2:69938773-69938795 CATGGACCTCACCACCAGTGAGG + Exonic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
936465077 2:112740711-112740733 CTGAGACCTGACCTGCAGTGAGG - Intronic
942488565 2:176466546-176466568 CCCAGACCTGACCTACACAGTGG - Intergenic
948384471 2:237572966-237572988 CCAGGCCTTGACCTTCAGTGGGG - Intergenic
948896604 2:240930606-240930628 ACCAGGACTGACCTCCAGTGTGG - Intronic
1168836625 20:881900-881922 CTGGGGCCTGAACTCCAGTGAGG + Intronic
1169006051 20:2207791-2207813 CTCAGAGCTGACGTCCAGTGCGG + Intergenic
1170532916 20:17312573-17312595 ACCTGACCTGACCCCCAGTTAGG + Intronic
1173000584 20:39102588-39102610 CCCAGCCCTGATCTCCAGGGTGG + Intergenic
1175216101 20:57392326-57392348 CCTGGACTTGCCCACCAGTGAGG - Intronic
1175399449 20:58692517-58692539 GACGGGCCTGGCCTCCAGTGGGG - Intronic
1179658505 21:42860288-42860310 CCCGGCCCAGTCCTCCTGTGAGG + Intronic
1179904745 21:44416702-44416724 CCTGGAGCTGGCCTCCCGTGTGG + Intronic
1179980840 21:44894898-44894920 GCAGGAGCTGACCTGCAGTGGGG + Intronic
1182869369 22:33632685-33632707 CCAGGACCTGACCAACACTGAGG + Intronic
1183466854 22:37984342-37984364 CTCGGACCTCTCCTCCAGTCTGG + Exonic
950094725 3:10322168-10322190 CCAGGCTCTGTCCTCCAGTGTGG - Intergenic
953136982 3:40189935-40189957 CCTGGAGGTGGCCTCCAGTGTGG + Exonic
953238602 3:41127710-41127732 CCAGGACATGACCTCATGTGGGG - Intergenic
954648495 3:52145536-52145558 CCCTGACCAGAGCCCCAGTGAGG + Intronic
958977325 3:100682580-100682602 CCCGGAAGTGACCTCCAGTCAGG + Intronic
961637690 3:128343374-128343396 CCTAGACCTGCCCTCAAGTGGGG + Intronic
964796778 3:160506617-160506639 CCTGGGTCTTACCTCCAGTGAGG + Intronic
968702920 4:2065254-2065276 CCCAGCCCTGGCCTGCAGTGTGG + Exonic
982925774 4:161335453-161335475 CCTTGACCTAACCTCCAGGGTGG - Intergenic
985504799 5:272530-272552 CCAGGAGCCGACGTCCAGTGTGG - Intronic
985590024 5:759773-759795 CCTGCACCTGACCTCCCTTGGGG + Intronic
985743316 5:1633065-1633087 CCAGGAGCCGACGTCCAGTGTGG + Intergenic
986191003 5:5495781-5495803 CCCGAATCTGACCTCCAGAAAGG + Intergenic
986191239 5:5497954-5497976 CCCGAATCTGACCTCCAGAAAGG + Intergenic
991474967 5:67009773-67009795 CCCAGACCTAAACCCCAGTGTGG - Intronic
996144033 5:119951456-119951478 CTCTGAGCTGACCTGCAGTGTGG + Intergenic
997691565 5:135830974-135830996 CCAGGTCGTGACCTCCTGTGAGG + Intergenic
1000022833 5:157333425-157333447 TGAGGACCTGACCTCCATTGTGG + Exonic
1006642504 6:35496525-35496547 CCCGGATATGAGCTCCAGGGTGG + Intronic
1007116331 6:39345693-39345715 CACAGACCTGTCTTCCAGTGGGG + Exonic
1012549422 6:100453880-100453902 CCCGGACCTGACAGGCAGTTTGG + Intronic
1013173902 6:107661514-107661536 CCCAGCCCCTACCTCCAGTGTGG + Intergenic
1019304679 7:327618-327640 CCCTGCCCTGGCCTCCAGGGTGG + Intergenic
1019518368 7:1449629-1449651 CCCGGAGCTGGCCTTCAGCGGGG - Intronic
1019745953 7:2700468-2700490 CCCGAAGCTGAACTCCTGTGCGG - Exonic
1020009638 7:4800943-4800965 GCCGGCCCTGGCCTCCTGTGAGG - Intronic
1023119171 7:36892250-36892272 CTGGGGCCTGACCACCAGTGGGG - Intronic
1029661536 7:101965482-101965504 CCTGGCCCTGTCCTGCAGTGGGG + Intronic
1029704670 7:102269987-102270009 CCCGGGCCTGGCCCCCTGTGGGG - Intronic
1034357696 7:150465485-150465507 CCCTGACCTGAAATCAAGTGAGG - Intronic
1035674880 8:1449572-1449594 CCCGTTCCTGAGCTCCAGGGTGG + Intergenic
1037602173 8:20406320-20406342 GACAGACCTGACTTCCAGTGAGG - Intergenic
1037668946 8:20997779-20997801 CCAGGACCACACCTCCGGTGTGG + Intergenic
1038734464 8:30156533-30156555 CCCAGACCTGGCGTCCACTGAGG + Intronic
1046985411 8:120382274-120382296 CCTGGACCCAACCTCCAGTTTGG + Intronic
1047423749 8:124727777-124727799 CCCGGCCCTTCCCTGCAGTGTGG - Intronic
1049353810 8:142177954-142177976 CCTGGGCCTGGCCTCCAGAGAGG + Intergenic
1049784398 8:144443722-144443744 CCCGGGCCAGTCCTCCGGTGGGG - Intronic
1049838378 8:144754792-144754814 CCCCGAACTTACCTTCAGTGGGG + Exonic
1049844224 8:144792272-144792294 CCCGGACCGGCCCTCCTGAGAGG - Intronic
1050266737 9:3898690-3898712 CCCGGGCCTGACCTCTATTCAGG - Exonic
1053093972 9:35308014-35308036 TCAGGACCTTAACTCCAGTGAGG + Intronic
1054744589 9:68841978-68842000 CCAGGACCTGAGCCACAGTGTGG - Intronic
1055776293 9:79770057-79770079 CTAAGACCTGCCCTCCAGTGGGG - Intergenic
1056795523 9:89656174-89656196 ACCGGACCTGAGCTCCAGCCAGG - Intergenic
1059522615 9:114957731-114957753 GCCAGATCTGACTTCCAGTGTGG - Intergenic
1062224614 9:135442631-135442653 CCAGGAACCGACCCCCAGTGGGG - Intergenic
1062524869 9:136974110-136974132 GGCGGGCCTGACCTCCAGGGTGG + Intergenic
1062574780 9:137200960-137200982 ACCGGAGCTGGCCTCCATTGGGG + Intronic
1186357584 X:8803359-8803381 CCCAAGCCTGACATCCAGTGTGG + Intergenic
1191256097 X:58280256-58280278 GAAGGCCCTGACCTCCAGTGGGG + Intergenic
1195668871 X:107452666-107452688 CCCAGACCTCTCCTCCAGTGGGG - Intergenic