ID: 1122865542

View in Genome Browser
Species Human (GRCh38)
Location 14:104602376-104602398
Sequence CACCTCCTGGGTGTCCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122865542_1122865546 8 Left 1122865542 14:104602376-104602398 CCCTGAGGGACACCCAGGAGGTG 0: 1
1: 0
2: 3
3: 36
4: 237
Right 1122865546 14:104602407-104602429 CGTGAGCGATGAACCAACTGTGG 0: 1
1: 0
2: 0
3: 3
4: 45
1122865542_1122865547 18 Left 1122865542 14:104602376-104602398 CCCTGAGGGACACCCAGGAGGTG 0: 1
1: 0
2: 3
3: 36
4: 237
Right 1122865547 14:104602417-104602439 GAACCAACTGTGGCCCCACCTGG 0: 1
1: 0
2: 1
3: 14
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122865542 Original CRISPR CACCTCCTGGGTGTCCCTCA GGG (reversed) Intronic
900187528 1:1339392-1339414 CGCCGCCTGGCTGTCCCACACGG - Exonic
900432685 1:2610503-2610525 CAGCTCCTGGCTGTCCGCCAGGG + Intronic
901637274 1:10676151-10676173 CACATTCTGTGTGACCCTCAGGG - Intronic
902604744 1:17562812-17562834 CACCTCTTGGGTGCCCAGCATGG - Intronic
902622886 1:17660628-17660650 AAGCCCCTGGGTCTCCCTCAGGG - Intronic
903846886 1:26284139-26284161 CACCTGCAAGGTGTCCCTGATGG + Exonic
903849671 1:26298233-26298255 TACCTCCTGGGTGTGTTTCAAGG - Intronic
904915508 1:33967572-33967594 CACCTGTTGGGTGACCATCATGG - Intronic
907269869 1:53284557-53284579 CACCTCCAGGGTGGACCTCCAGG + Intronic
907312711 1:53548196-53548218 CACATCCAGGGTGTGCCCCAGGG + Intronic
908116221 1:60942996-60943018 TACCTCCTGCTTGTCCTTCAAGG - Intronic
909301203 1:74015126-74015148 CACCTGATGGGTGTCCCTCTGGG + Intergenic
909497117 1:76290817-76290839 CAGCTGCTGTGTGTCCCTGAAGG + Intronic
910685954 1:89916765-89916787 CAAATCCTGGGTTTTCCTCAGGG + Intronic
912480718 1:109980522-109980544 CACCCTCTGGGGGTCCCTAAGGG + Intergenic
913199243 1:116482711-116482733 TGCCTCCTGGGTGTCCTTCATGG + Intergenic
913720302 1:121586528-121586550 CATCTGCTGGGTGCCCCTCTGGG - Intergenic
914997562 1:152558371-152558393 GTCTCCCTGGGTGTCCCTCATGG - Intronic
918311080 1:183285933-183285955 GACCGCCTGGGTGTGACTCATGG + Intronic
918543463 1:185656959-185656981 CACCTCCTGGATGTCAGCCAAGG + Intergenic
918740872 1:188128786-188128808 CACCTACTGGATTTCCCTCAGGG + Intergenic
920031337 1:203039042-203039064 GACCGCCTGGGTCCCCCTCATGG + Intronic
920345489 1:205303498-205303520 CACCTCCTGGCAGTCTGTCAGGG + Exonic
922024693 1:221739582-221739604 CACCACCGTTGTGTCCCTCAAGG - Exonic
922499558 1:226086454-226086476 CCGCTCCAGGGTGTCCCTGAAGG - Intergenic
924284090 1:242467719-242467741 CACCACCTGGTGGGCCCTCATGG - Intronic
924357885 1:243202900-243202922 TACCTCCTGGGAGTGCCTGAAGG + Intronic
924834458 1:247635090-247635112 CATCTGGTGGGTGTCCCTCTGGG - Intergenic
1062937586 10:1399863-1399885 GGCCTCCTGTGTGTCCCTCAGGG - Intronic
1062946504 10:1465741-1465763 CACATTCTGGGTGGCCCTCTGGG - Intronic
1065411592 10:25435403-25435425 CACCTCCTGGTTATCCTTGAGGG - Intronic
1066136482 10:32452100-32452122 CATCTCCTGGGTGACTCTAAAGG - Intronic
1066198575 10:33125280-33125302 CATCCCCTGGCTGTCCCTGATGG + Intergenic
1066461992 10:35620332-35620354 CACCTCCTTGGTGACCCTAAGGG + Intergenic
1067943290 10:50674695-50674717 CGCAGCCTGGGTGTCCCGCAGGG + Intergenic
1068248565 10:54406420-54406442 CACCTCATATGTGTCCCACAAGG - Intronic
1069712176 10:70496811-70496833 AACCTCCTCGGTCTCCCTCTTGG - Intronic
1070287655 10:75095394-75095416 AGCCTCCAGGGTGTCCCTGAAGG + Intronic
1070319337 10:75343119-75343141 CACCTCCTGTGTGTGTCTCCTGG + Intergenic
1070977230 10:80614947-80614969 CCCCTCCTGGGTAGCCCTCCTGG + Intronic
1071488898 10:86122810-86122832 CACGTCAGGGGTGGCCCTCAGGG - Intronic
1073207537 10:101776608-101776630 CACCTACTGTGTGTCCCGCCGGG + Intronic
1075735856 10:124664262-124664284 CACCTCCATGGAGTCCCTGAAGG + Intronic
1076871102 10:133195562-133195584 CAGTGCCTGGGTGCCCCTCAGGG + Intronic
1077266963 11:1655607-1655629 CACCTCCTGGCACTGCCTCAAGG - Intergenic
1077372943 11:2192220-2192242 CCCCTCCAGGGTGTACCCCAGGG - Intergenic
1078147429 11:8731085-8731107 CAGCTCCCGGGTGCTCCTCAAGG - Exonic
1078660075 11:13278647-13278669 CAGGTCCTGGGCGGCCCTCAAGG + Intronic
1079107450 11:17580541-17580563 CACCTGCTGTGTGCCCATCATGG - Intronic
1079111997 11:17610274-17610296 CACCTCCTCGGGATCCCACAAGG + Exonic
1079867985 11:25759057-25759079 CATCTCATGGGTGTTCCTCTGGG + Intergenic
1082998244 11:59269379-59269401 CTCCAGCTGGGGGTCCCTCAAGG - Intergenic
1083340330 11:61955098-61955120 CACCCCCAGGCTGGCCCTCACGG + Exonic
1084212075 11:67628979-67629001 CTCCTCCCGGGTTTCCCGCAGGG + Exonic
1088152086 11:106757731-106757753 CATCTCATGGGTGCCCCTCTGGG - Intronic
1088812530 11:113401165-113401187 CAATGCCTGGGTCTCCCTCATGG + Intergenic
1089498123 11:118918037-118918059 CACTTCCTTGGTGTCCCTTGGGG + Intronic
1089670212 11:120051610-120051632 CATCTCCTAGATGTCCCTAAAGG + Intergenic
1090672413 11:128957996-128958018 CCCTTCCTGGGTGTTCCTCTCGG - Intergenic
1091075165 11:132608735-132608757 CCCCTCCTGGGTCTTCCTAAGGG + Intronic
1093728491 12:22542568-22542590 AAAATCCTGGGTGTCCTTCAAGG + Intronic
1094524137 12:31220544-31220566 CACATCTTTGGTGTCTCTCAGGG + Intergenic
1096865425 12:54559937-54559959 CATCTCCTGGGTGGCATTCAGGG + Intronic
1097218865 12:57435118-57435140 CACCTCCACGGGGTCCCACAGGG + Exonic
1097700113 12:62811368-62811390 CACCTGCTCAGTGTCCCTCCAGG - Intronic
1098196038 12:68003509-68003531 CATCTCCCATGTGTCCCTCAAGG + Intergenic
1098438698 12:70496598-70496620 CAGCTGGTGGGTGTCCCTCTGGG - Intergenic
1099489997 12:83276613-83276635 CATCTGATGGGTGTCCCTCTGGG - Intergenic
1103361677 12:120358490-120358512 CTCCTCCTGGGTGTGCCCCAGGG + Intronic
1103721765 12:122979093-122979115 CACCTCCAGGGGCTCCGTCAGGG - Exonic
1104759147 12:131286845-131286867 CACCTCCTGGGTGTGTCTCAGGG - Intergenic
1104821463 12:131679651-131679673 CACCTCCTGGGTGTGTCTCAGGG + Intergenic
1105704405 13:22960497-22960519 CTCCTCCTGAGTGTCCCTGATGG + Intergenic
1106431386 13:29683824-29683846 CACCTTCTTGCTGTGCCTCATGG + Intergenic
1113292526 13:108922340-108922362 CAGCTTCTGTGTGTCCCTCATGG + Intronic
1113643563 13:111976072-111976094 CTCCTGCCCGGTGTCCCTCATGG - Intergenic
1113802627 13:113094474-113094496 CATCACCGGGGGGTCCCTCACGG + Intronic
1113927642 13:113950498-113950520 CACCCCCTGCCTGCCCCTCAAGG + Intergenic
1116775807 14:49179238-49179260 CATCTGGTGGGTGTCCCTCTGGG + Intergenic
1117276574 14:54200001-54200023 CACCTCCTGTGTGTCCTGTAAGG - Intergenic
1118975863 14:70676137-70676159 CACGCCCTGGGTGTCCCTCAAGG + Intergenic
1119018395 14:71084228-71084250 CACCTGCCGGGTGCCCCTCTGGG - Intronic
1119906449 14:78307462-78307484 CACTGCCTGGGTGTCTCACAAGG - Intronic
1119998401 14:79278027-79278049 CACCTCCTTGGGGTGTCTCAAGG + Intronic
1121022969 14:90592973-90592995 CACCTCCTGGCCCTCTCTCAGGG + Intronic
1122519850 14:102335524-102335546 CACCTACTGTGTGCCCCGCATGG - Intronic
1122773463 14:104107134-104107156 CCCCGCCTGGGTCTCCCTCAGGG + Intronic
1122825868 14:104370171-104370193 CTCCCCCTGTGTGTCTCTCATGG - Intergenic
1122865542 14:104602376-104602398 CACCTCCTGGGTGTCCCTCAGGG - Intronic
1202865443 14_GL000225v1_random:114299-114321 CATCACCTGGGTGTCCCTCTAGG - Intergenic
1202923560 14_KI270724v1_random:5044-5066 CACTGCCTGAGTGTCCCTCTAGG + Intergenic
1124363763 15:29056996-29057018 CACGGCCTGGCTGTCCCCCAGGG - Intronic
1124410672 15:29433715-29433737 CTGCTACTGGCTGTCCCTCAAGG + Intronic
1125019990 15:34975041-34975063 CACCAGATGAGTGTCCCTCATGG + Intergenic
1129225479 15:74168135-74168157 TACCTCCTGGTAGCCCCTCAGGG + Intergenic
1129457436 15:75683283-75683305 CTAGTCCTGTGTGTCCCTCAAGG + Intronic
1129726355 15:77903662-77903684 CTAGTCCTGCGTGTCCCTCAAGG - Intergenic
1132270031 15:100516119-100516141 GACCTCCTGTGTGCCACTCAAGG + Intronic
1133722521 16:8508362-8508384 CACATCCTGGGTGGCCAGCATGG - Intergenic
1134129260 16:11637565-11637587 CACGTGCTGTGTGCCCCTCATGG - Intergenic
1135592133 16:23712428-23712450 CACCTCATGGGTCCACCTCATGG - Intronic
1138345032 16:56315532-56315554 CACCTCCTGGGTATCTCTCCTGG - Intronic
1139681886 16:68571510-68571532 CACCTGCTTGGTTTCCCTCAGGG + Intronic
1141168711 16:81677716-81677738 CTCCTCCTGGGTAACCCTCCAGG - Intronic
1141720961 16:85754979-85755001 CACCTCCTAGGGGTCCTGCAGGG + Intergenic
1142066505 16:88065923-88065945 CACCTCCTTCCTGTCCCTCCTGG + Intronic
1142194598 16:88733590-88733612 CACCGTCTGGGTGGCCCTGAAGG - Exonic
1146266909 17:31458777-31458799 CACACCCTGGGTGACCCACAAGG - Intronic
1148106903 17:45123803-45123825 CAGCTCCAGAGGGTCCCTCAGGG + Intronic
1150124082 17:62625698-62625720 CACCTCCTGTGTGCCCGGCATGG + Intergenic
1151223471 17:72631290-72631312 CACCTCCTGGTTGTGCTCCACGG - Intergenic
1152657583 17:81527213-81527235 CATCTCCTGAGTGGCCATCATGG - Intergenic
1152666051 17:81570301-81570323 CGCCTCCTGGGTGCCCAGCACGG + Intronic
1152717295 17:81906234-81906256 CCCCTCCCGGCTGTCCCTCATGG + Intronic
1154326917 18:13397979-13398001 CACCTCCTGGGGCTGTCTCAGGG - Intronic
1156404365 18:36770370-36770392 CACCTCCTGTGTGAATCTCAAGG - Intronic
1157603859 18:48913363-48913385 CACCTGGTGGCAGTCCCTCATGG + Intergenic
1157604242 18:48915674-48915696 CAACTCCTGATTGTCCCTGAGGG - Intergenic
1158442988 18:57493711-57493733 CACCGCCTTGGGGTCCATCATGG + Intergenic
1160057034 18:75492691-75492713 CACCTCCTGCAAGTGCCTCAAGG + Intergenic
1160391920 18:78540438-78540460 CCCCTCTTGGATGTCTCTCAGGG - Intergenic
1160508498 18:79440547-79440569 CACCTGCTGGGTGTGGCCCAGGG - Intronic
1160991256 19:1861197-1861219 CGCCTCTTGGGTGCCACTCAGGG + Intronic
1161170389 19:2809833-2809855 GAACTCCTGGGTGATCCTCAAGG - Intronic
1161738861 19:6008060-6008082 CAGCTCCTGCGTGTCCCTCCCGG - Intronic
1162084210 19:8238624-8238646 CACCTGCTGGGGGATCCTCATGG + Intronic
1162199452 19:9010154-9010176 GACCTCCTGGCTGTCCCTGCTGG + Intergenic
1163378337 19:16948182-16948204 CACCTACTGGGTGCCCCGCTAGG + Intronic
1164749615 19:30642891-30642913 CACCTCAGTTGTGTCCCTCAGGG - Intronic
1165062938 19:33213735-33213757 CACCCCATAGGTCTCCCTCAGGG - Intronic
1165103929 19:33457481-33457503 CACCTCCTGGCTGTCCTTACTGG + Intronic
1165532147 19:36412645-36412667 CAGCTCCTAGGTGGGCCTCATGG - Intronic
1165778938 19:38420937-38420959 CAGCTCCTGGGTGTCCCCTGTGG + Exonic
1165929266 19:39345530-39345552 GACCTCCTGAGGGTGCCTCAAGG - Intronic
1166924850 19:46260494-46260516 CAGCTCCCAGGCGTCCCTCATGG - Intergenic
1167749335 19:51370509-51370531 CTGCTCCTGGCTGCCCCTCAGGG + Intergenic
1168113718 19:54209245-54209267 CACCTCCTGGACGTCCCCCTGGG - Intronic
1168146104 19:54420782-54420804 CACCTCCTGGGGGTTCCTAAGGG - Intronic
925215093 2:2087451-2087473 CCCCTCCTGGGTGTCCTTTCAGG - Intronic
925361176 2:3281269-3281291 CTCCTTCTCGGTGTCCCTCCAGG + Intronic
925422499 2:3724424-3724446 CACCTCCCTGGTCTCCTTCAGGG + Intronic
926458486 2:13098836-13098858 CCCCTCATGGGTGTTCCACATGG - Intergenic
927047534 2:19294998-19295020 CAGCTCCTGGGAGCCACTCAGGG + Intergenic
929256059 2:39813052-39813074 CATCTGTTGGGTGCCCCTCAGGG - Intergenic
931480476 2:62634039-62634061 CATCTGGTGGGTGTCCCTCTGGG + Intergenic
932583586 2:73008442-73008464 CAGGGCCTGGGTTTCCCTCATGG - Intronic
932600735 2:73123416-73123438 TACCTTCTGGGTCTCCTTCAGGG + Intronic
934717392 2:96551770-96551792 AGCCTGCTGGGTGTCCCCCATGG + Exonic
936066366 2:109335436-109335458 CACCTCCTCTCTGCCCCTCAGGG + Intronic
937233416 2:120415951-120415973 CACCTCCTGGGAGGCCTTGAGGG + Intergenic
937236329 2:120433691-120433713 CACCCACTAGGTGTCCCACAAGG - Intergenic
938168061 2:129050028-129050050 CATCTGGTGGGTGTCCCTCTGGG - Intergenic
938198917 2:129357089-129357111 CCCCTCATGGGTGTCCCTGCAGG + Intergenic
942898840 2:181089978-181090000 CATCTGCTGGGTGCCCCTCTGGG + Intergenic
943660576 2:190554918-190554940 CAACTCGTGGGTGCCCCTCTGGG + Intergenic
944267986 2:197748996-197749018 CATCTGGTGGGTGTCCCTCTGGG + Intronic
945409880 2:209495446-209495468 CATCTGGTGGGTGTCCCTCTGGG + Intronic
946053233 2:216880950-216880972 CCCCTCCTTGGTGTCCTTCATGG + Intergenic
947498521 2:230656242-230656264 CCCATTCTGGGTGGCCCTCAAGG - Intergenic
1168972703 20:1941673-1941695 CACCTCCTTGGGGTTCCTCCTGG + Intergenic
1169412409 20:5382979-5383001 CAGCTCCTGAGTGCACCTCAAGG + Intergenic
1170420297 20:16186018-16186040 CCCAGCCTGCGTGTCCCTCAAGG + Intergenic
1171042494 20:21778489-21778511 CACCTGATGGTTCTCCCTCATGG - Intergenic
1172952698 20:38731944-38731966 CACTTCCTGGATGGCCCCCATGG - Intergenic
1175220803 20:57415315-57415337 TACCTCCTGGGCCTCCCGCAGGG + Intergenic
1175521911 20:59607250-59607272 CTCCTGCTGGGTGTTACTCAGGG + Intronic
1175905794 20:62378720-62378742 CACCTCCTGGGAGGCCCACGAGG - Intergenic
1177136452 21:17309379-17309401 CATCTCGTGGGTGCCCCTCTGGG + Intergenic
1179192787 21:39137427-39137449 CACCTCCTGGGTTTCCTTCCAGG - Intergenic
1179981886 21:44900073-44900095 CAGAGCCTGGGTGTCCCACAAGG + Intronic
1181140239 22:20799198-20799220 GACCTTCGGGGTGTCCCTCAAGG + Exonic
1181577244 22:23802758-23802780 ATCCTCCTGGGACTCCCTCAGGG + Intronic
1182258941 22:29058911-29058933 TACCTCTTGGGGGTCCCTGAAGG + Exonic
1183264578 22:36817359-36817381 CACCTCCTGCGTGTCCTTGACGG - Intronic
1183345793 22:37307035-37307057 CACCTCCTCAGTTTCCCTCTGGG - Intronic
1183654094 22:39175134-39175156 CCCCACCTGGGGGCCCCTCACGG - Intergenic
1184119641 22:42441449-42441471 AACCACCTGGGCCTCCCTCATGG + Intergenic
1184281708 22:43441118-43441140 CTCCTCCTGGGTGTCTGCCAGGG + Intronic
1184417237 22:44359432-44359454 CATCCTCTGGGTGTCCATCAGGG + Intergenic
1185113616 22:48918763-48918785 CACCGCCTGGATGTTGCTCATGG - Intergenic
949187208 3:1206455-1206477 CACCACCAGGGTGTCACTCAAGG + Intronic
950190882 3:10975276-10975298 CATCTCCTGGGTGTATCACAAGG + Intergenic
950728928 3:14939326-14939348 CACCTCCTGGGGTTCCCTCTGGG + Intergenic
952955675 3:38555860-38555882 CACCTCCTGGCTTTCTCTCCTGG + Intronic
954381485 3:50221328-50221350 CCCTTCCTGGGGCTCCCTCAGGG - Intergenic
961714926 3:128851738-128851760 CTCCTCCTGGGTCTCCCACATGG + Intergenic
962156943 3:132957472-132957494 CATCTGGTGGGTGTCCCTCTGGG + Intergenic
962786915 3:138777160-138777182 CACCACCAATGTGTCCCTCATGG + Intronic
962835673 3:139186363-139186385 CCCCTCCTGTCTGTGCCTCAGGG + Intronic
963805897 3:149722635-149722657 CACCTTCTGGAATTCCCTCAAGG + Intronic
964264235 3:154875730-154875752 CATCTGGTGGGTGTCCCTCTGGG + Intergenic
965300492 3:167000434-167000456 CTCCTGCTGGGTGTGCCTCTGGG + Intergenic
965422941 3:168484890-168484912 CACCTCTTGGCTCTCCCACAGGG - Intergenic
968190042 3:196660880-196660902 CAGCTCCTGGGCGTCCCCCCTGG + Exonic
969338148 4:6523704-6523726 CCACTCCTGGGTGTCTATCACGG + Intronic
969395569 4:6918457-6918479 CACCTGCTGTGTGTCAGTCAGGG + Intronic
969704403 4:8784119-8784141 CACCTGCTGGGTGACCTTCATGG - Intergenic
969724513 4:8911337-8911359 CACCGCCTGCTTGTTCCTCACGG + Intergenic
970108929 4:12616293-12616315 CAGCTCCAGTGTGTCCTTCAGGG - Intergenic
973273091 4:48280675-48280697 CATCTGGTGGGTGTCCCTCTGGG + Intergenic
976862632 4:89684599-89684621 CAAATCCTGGCTGTCCTTCAGGG + Intergenic
978374143 4:108057550-108057572 CAGCTCCTGGCAGACCCTCAGGG + Intronic
978392565 4:108242477-108242499 CACTTCCTAGGTGTCACCCAGGG + Intergenic
978617531 4:110611795-110611817 CACCTCCGGGGTCGCCCTCTTGG - Intergenic
979243925 4:118476582-118476604 TACCTCCTGGGAGTGCCTGAAGG - Intergenic
982822948 4:159966990-159967012 CACCTCCTAGGTTTCTCTCAAGG + Intergenic
983179535 4:164631203-164631225 CATCTGGTGGGTGTCCCTCTGGG + Intergenic
984525967 4:180860115-180860137 CATCTGGTGGGTGTCCCTCTGGG - Intergenic
984786475 4:183571902-183571924 CACCTCCTGGGCGTTCTTCCAGG + Intergenic
984952262 4:185016638-185016660 CACCCCTAGGGTGTCCCTCTCGG - Intergenic
986879671 5:12154260-12154282 CATCTCATGGGTGCCCCTCTGGG + Intergenic
988618300 5:32795769-32795791 CATCTGGTGGGTGCCCCTCAGGG + Intergenic
988719291 5:33859770-33859792 CATCTCGTGGGTGCCCCTCTGGG + Intronic
990026003 5:51189989-51190011 AAGCTCTTGGGTGGCCCTCAGGG - Intergenic
991899694 5:71447369-71447391 CACCTCCTGGGTCTCCTGCAGGG - Intergenic
992768703 5:80027380-80027402 CAATTCCTGGATTTCCCTCATGG - Intronic
992902283 5:81309625-81309647 CATGTCCTGGGTTTCCCTCCTGG + Intronic
995691527 5:114831091-114831113 CAACTCAGGGGTGTCCCTGAAGG + Intergenic
997584574 5:135036749-135036771 CACCTGCTGTGTGCCCCTCTGGG + Intronic
1000798293 5:165692792-165692814 CATCTGGTGGGTGTCCCTCTGGG - Intergenic
1001680270 5:173551873-173551895 CATCTCCTGCATTTCCCTCATGG + Intergenic
1002779101 6:352863-352885 CATCTCCAGGGTGACCCACAAGG - Intergenic
1003306645 6:4934981-4935003 CAACTCCTGAGTGTCCCACAGGG + Intronic
1004417112 6:15435146-15435168 CATCTGCTGGGTTTTCCTCATGG + Intronic
1006346744 6:33488548-33488570 CACCTGATGGGTTTCCCTGAAGG - Intergenic
1007266968 6:40603886-40603908 TCCCTCCTGGGAGCCCCTCATGG + Intergenic
1007527158 6:42506436-42506458 CACCTCATGGGGGTCCCATAAGG - Intergenic
1007618746 6:43198721-43198743 CACCTCCGGGGCTGCCCTCACGG - Exonic
1009176254 6:60462801-60462823 CAGCTCATGGGTGTACCTGAAGG + Intergenic
1009336145 6:62492783-62492805 CATCTGGTGGGTGCCCCTCAGGG + Intergenic
1012208623 6:96492800-96492822 CACCTGCTGTGTACCCCTCACGG - Intergenic
1013608972 6:111776241-111776263 CAACCCCTGGGTGATCCTCAGGG - Intronic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1019579296 7:1752164-1752186 CAGCTCCTGATTGTCCTTCAGGG - Intergenic
1019827307 7:3295016-3295038 CACATCCTGGGGGTCCCTAATGG - Intergenic
1021414900 7:20372434-20372456 CAGATCCTGGGAGTCCCACATGG - Intronic
1022508720 7:30922219-30922241 CACCTCCTGGCTGTGAGTCAGGG + Exonic
1024420618 7:49161480-49161502 TACCTCCTGGGAGTCACCCAAGG + Intergenic
1026074746 7:67156296-67156318 CACCACCTGCGTGTCTCCCAGGG - Intronic
1027358939 7:77388385-77388407 CACAGGCTGGGTTTCCCTCAGGG + Intronic
1027910633 7:84245733-84245755 CATCTTGTGGGTGTCCCTCTGGG - Intronic
1029293425 7:99519857-99519879 CAGCTCCTGGCTGTCCTTCAGGG - Exonic
1029335065 7:99892039-99892061 CATCTTCTGGGTCTCCCTAACGG - Exonic
1031440465 7:121788464-121788486 CAGCTCATGGCTGTCCCTCTTGG - Intergenic
1032080425 7:128855963-128855985 CGCCTCCTGGCTGCCCCTCAGGG + Intronic
1032643849 7:133799309-133799331 CAGCTCCTGGATGTCTTTCATGG - Intronic
1034933332 7:155181865-155181887 CACATCCTGGGTGTCCTTTTGGG - Intergenic
1038334682 8:26636611-26636633 CTCCTCCTCTCTGTCCCTCAGGG + Intronic
1038406514 8:27326296-27326318 CGCCTCCTGAGTGCCACTCAAGG + Intronic
1039267534 8:35841870-35841892 CAGCACCTGGCTGGCCCTCATGG + Intergenic
1042687811 8:71461780-71461802 CACAGCCAGGGTGTCCCTCAGGG + Intronic
1042699427 8:71595867-71595889 CACATCCTGGATTTCCCTCAAGG - Intergenic
1046067899 8:109218392-109218414 CATCTGGTGGGTGTCCCTCTGGG - Intergenic
1047290149 8:123522774-123522796 CAAATCCTGGCCGTCCCTCAAGG + Intronic
1047884675 8:129236062-129236084 CACCTCTTGAGTGCCCATCATGG - Intergenic
1048339731 8:133529407-133529429 GACCTGCTGGCTGTCCCTTATGG + Intronic
1049604984 8:143525211-143525233 CAGCTCCTGGGGGAGCCTCAGGG - Intronic
1049743040 8:144250107-144250129 CATCTCATGGGGCTCCCTCATGG + Intronic
1052966303 9:34343160-34343182 TTCCTCTTGGGTCTCCCTCAGGG - Exonic
1056856977 9:90140182-90140204 CACACTCTGTGTGTCCCTCAGGG + Intergenic
1057911878 9:99025906-99025928 CAACTCCAGGCTGTCCCTCAGGG - Exonic
1061605638 9:131708551-131708573 CACTTCCTGGGTGTCCAGGATGG + Intronic
1061715623 9:132517097-132517119 CCACTTCTGGGTGTCCCTCATGG + Intronic
1061807484 9:133144460-133144482 CACCTCATGGGTGACACACACGG - Intronic
1061986150 9:134131474-134131496 CACCTGCTGTGTGTCCCTCCTGG + Intergenic
1062138777 9:134944112-134944134 CACCTCCCAGGTTTCCCTGAGGG + Intergenic
1062374503 9:136255867-136255889 CACCACCTGAGTGACCCTGAGGG + Intergenic
1062462634 9:136668281-136668303 CACCTCCTGAGAGCCCCTCATGG - Exonic
1185446024 X:258394-258416 CCCTCCCTGGGAGTCCCTCAAGG - Intergenic
1191606329 X:63066394-63066416 CATCTGGTGGGTGTCCCTCTGGG + Intergenic
1192992197 X:76471996-76472018 CACCTAGTGGGTGCCCCTCTGGG + Intergenic
1195155916 X:102125019-102125041 CACCGCCTGAGTGTCCCTGAGGG - Intergenic
1195158195 X:102143081-102143103 CACCGCCTGAGTATCCCTGAGGG + Intergenic
1197763974 X:130047426-130047448 CTCCTCCTGTGTGCCACTCATGG + Intronic
1200117240 X:153774723-153774745 CACCTTCTGGTAGTCCCGCAGGG - Exonic
1200121636 X:153793961-153793983 CACCTCCTTAGTGTCCTTGAAGG - Exonic
1201266650 Y:12213295-12213317 CACATCCTGTGTGTACCTCTTGG + Intergenic