ID: 1122869786 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:104633027-104633049 |
| Sequence | CAAGTTATGCACAGGGTGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1122869786_1122869797 | 13 | Left | 1122869786 | 14:104633027-104633049 | CCACACACCCTGTGCATAACTTG | No data | ||
| Right | 1122869797 | 14:104633063-104633085 | CCCTTGCTTTGCAGTGTAGAGGG | No data | ||||
| 1122869786_1122869795 | 12 | Left | 1122869786 | 14:104633027-104633049 | CCACACACCCTGTGCATAACTTG | No data | ||
| Right | 1122869795 | 14:104633062-104633084 | GCCCTTGCTTTGCAGTGTAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1122869786 | Original CRISPR | CAAGTTATGCACAGGGTGTG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||