ID: 1122869786

View in Genome Browser
Species Human (GRCh38)
Location 14:104633027-104633049
Sequence CAAGTTATGCACAGGGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122869786_1122869797 13 Left 1122869786 14:104633027-104633049 CCACACACCCTGTGCATAACTTG No data
Right 1122869797 14:104633063-104633085 CCCTTGCTTTGCAGTGTAGAGGG No data
1122869786_1122869795 12 Left 1122869786 14:104633027-104633049 CCACACACCCTGTGCATAACTTG No data
Right 1122869795 14:104633062-104633084 GCCCTTGCTTTGCAGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122869786 Original CRISPR CAAGTTATGCACAGGGTGTG TGG (reversed) Intergenic
No off target data available for this crispr