ID: 1122869983

View in Genome Browser
Species Human (GRCh38)
Location 14:104634104-104634126
Sequence GCGGCGAGTTTTCACCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122869983_1122869987 13 Left 1122869983 14:104634104-104634126 CCCATCAGGTGAAAACTCGCCGC No data
Right 1122869987 14:104634140-104634162 GTCAGAATCTACGAGCAGCATGG No data
1122869983_1122869990 29 Left 1122869983 14:104634104-104634126 CCCATCAGGTGAAAACTCGCCGC No data
Right 1122869990 14:104634156-104634178 AGCATGGGAGCCCGCCTGGCTGG No data
1122869983_1122869988 14 Left 1122869983 14:104634104-104634126 CCCATCAGGTGAAAACTCGCCGC No data
Right 1122869988 14:104634141-104634163 TCAGAATCTACGAGCAGCATGGG No data
1122869983_1122869989 25 Left 1122869983 14:104634104-104634126 CCCATCAGGTGAAAACTCGCCGC No data
Right 1122869989 14:104634152-104634174 GAGCAGCATGGGAGCCCGCCTGG No data
1122869983_1122869991 30 Left 1122869983 14:104634104-104634126 CCCATCAGGTGAAAACTCGCCGC No data
Right 1122869991 14:104634157-104634179 GCATGGGAGCCCGCCTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122869983 Original CRISPR GCGGCGAGTTTTCACCTGAT GGG (reversed) Intergenic
No off target data available for this crispr