ID: 1122871383

View in Genome Browser
Species Human (GRCh38)
Location 14:104640594-104640616
Sequence TGGGCATCACTAGAGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122871383_1122871393 -2 Left 1122871383 14:104640594-104640616 CCAACCCCCTCTAGTGATGCCCA No data
Right 1122871393 14:104640615-104640637 CACCACGTGCGGGGTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122871383 Original CRISPR TGGGCATCACTAGAGGGGGT TGG (reversed) Intergenic
No off target data available for this crispr