ID: 1122873409

View in Genome Browser
Species Human (GRCh38)
Location 14:104651636-104651658
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122873407_1122873409 3 Left 1122873407 14:104651610-104651632 CCTGGGGACAAAGCGGGGCAGCG No data
Right 1122873409 14:104651636-104651658 TGTCAGTGAGAAGTGGCCGCAGG No data
1122873400_1122873409 23 Left 1122873400 14:104651590-104651612 CCTCTTTGAAACTCACAGAACCT No data
Right 1122873409 14:104651636-104651658 TGTCAGTGAGAAGTGGCCGCAGG No data
1122873398_1122873409 25 Left 1122873398 14:104651588-104651610 CCCCTCTTTGAAACTCACAGAAC No data
Right 1122873409 14:104651636-104651658 TGTCAGTGAGAAGTGGCCGCAGG No data
1122873399_1122873409 24 Left 1122873399 14:104651589-104651611 CCCTCTTTGAAACTCACAGAACC No data
Right 1122873409 14:104651636-104651658 TGTCAGTGAGAAGTGGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122873409 Original CRISPR TGTCAGTGAGAAGTGGCCGC AGG Intergenic
No off target data available for this crispr