ID: 1122873544

View in Genome Browser
Species Human (GRCh38)
Location 14:104652252-104652274
Sequence GGGTGGACACACACTTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122873544_1122873555 5 Left 1122873544 14:104652252-104652274 CCCCACCAAGTGTGTGTCCACCC No data
Right 1122873555 14:104652280-104652302 ACCATGGCTGCTCCCCACGTTGG No data
1122873544_1122873563 26 Left 1122873544 14:104652252-104652274 CCCCACCAAGTGTGTGTCCACCC No data
Right 1122873563 14:104652301-104652323 GGCTCAGGGAGCCCCTGAGGAGG No data
1122873544_1122873562 23 Left 1122873544 14:104652252-104652274 CCCCACCAAGTGTGTGTCCACCC No data
Right 1122873562 14:104652298-104652320 GTTGGCTCAGGGAGCCCCTGAGG No data
1122873544_1122873557 11 Left 1122873544 14:104652252-104652274 CCCCACCAAGTGTGTGTCCACCC No data
Right 1122873557 14:104652286-104652308 GCTGCTCCCCACGTTGGCTCAGG No data
1122873544_1122873558 12 Left 1122873544 14:104652252-104652274 CCCCACCAAGTGTGTGTCCACCC No data
Right 1122873558 14:104652287-104652309 CTGCTCCCCACGTTGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122873544 Original CRISPR GGGTGGACACACACTTGGTG GGG (reversed) Intergenic
No off target data available for this crispr